Multiple Choice
Which of the choices best describes macroevolution?
A) Individuals with one genotype reproduce more than individuals with another genotype in a population.
B) Many individuals move into a new area.
C) Mutation creates new alleles that are dominant.
D) A new species emerges.
E) Dominant and recessive allele frequencies are in equilibrium in a population.
Correct Answer:
Verified
Correct Answer:
Verified
Q21: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A) VNTR.<br>B)
Q22: Who invented DNA profiling?<br>A) Godfrey Hardy<br>B) William
Q23: A series of markers have the following
Q24: An autosomal recessive disorder strikes 1 in
Q25: A suspect's guilt seems highly likely when
Q27: For a very rare inherited disease,the frequency
Q28: All of the genes in a population
Q29: An RFLP is a<br>A) DNA probe used
Q30: The allele T is in 85 percent
Q31: The parts of the genome that are