Multiple Choice
A series of markers have the following frequencies.Which would be the most useful for DNA profiling?
A) 1/60
B) 1/5,200
C) 1/500
D) 1/40
E) 1/10
Correct Answer:
Verified
Correct Answer:
Verified
Related Questions
Q18: Hardy-Weinberg equilibrium is possible only if the
Q19: Frequency of an X-linked recessive allele in
Q20: Principles of population genetics must be applied
Q21: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A) VNTR.<br>B)
Q22: Who invented DNA profiling?<br>A) Godfrey Hardy<br>B) William
Q24: An autosomal recessive disorder strikes 1 in
Q25: A suspect's guilt seems highly likely when
Q26: Which of the choices best describes macroevolution?<br>A)
Q27: For a very rare inherited disease,the frequency
Q28: All of the genes in a population