The DNA Molecule Below Is Believed to Contain a Binding

Question 12

Not Answered

The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5' end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below, there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site for protein X.
*(5')GGATTCTAATAAAGTAACGCGTTACGACTTGG
CCTAAGATTATTTCATTGCGCAATGCTGAACC The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5' end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below, there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site for protein X. *(5')GGATTCTAATAAAGTAACGCGTTACGACTTGG CCTAAGATTATTTCATTGCGCAATGCTGAACC [ [

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q7: Which factor is NOT usually essential for

Q8: Which statement is TRUE regarding the

Q9: Aptamers are:<br>A) double-stranded RNA products of nuclease

Q10: Which statement is NOT true of the

Q11: Which characteristic does NOT apply to

Q13: Splicing of introns in nuclear mRNA primary

Q14: In 1989, Sidney Altman won a Nobel

Q15: E. coli RNA polymerase (RNAP) has no

Q16: Which property of the L-19 IVS ribozyme

Q17: Explain why splicesosomal introns likely evolved from