In Frogs, Green Skin Is Determined by Gene B

Multiple Choice

In frogs, green skin is determined by gene B.The wild-type sequence of the 5′ end of the RNA-like strand of the entire first exon is shown below.The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin.
5′ ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3′
The table of codons is provided here:
-Which are the first three amino acids encoded by the wild-type sequence of gene B?

A) N-Thr-Gln-Ala…
B) N-Pro-Asn-Asn…
C) N-Met-Phe-Leu…
D) N-Ser-Ser-Val…
E) The correct sequence is not shown here.