The Sequence of Gene B from Another Baby Frog Who

Multiple Choice

The sequence of gene B from another baby frog who is homozygous for allele b² is shown.What effect does the mutation in allele b² have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′

A) Allele b² has a frameshift mutation-a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on.
B) Allele b² has a deletion of one nucleotide outside of the coding region and there is no effect on the protein.
C) Allele b² has a missense mutation-a nucleotide substitution that changes one amino acid to another.
D) Allele b² has a nonsense mutation-a nucleotide substitution that forms a stop codon.
E) Allele b² has a silent mutation-a nucleotide substitution that does not change the protein.