Solved

If the Incidence of Tay-Sachs Is 1/3,600 Ashkenazim Births,what Is

Question 16

Multiple Choice

If the incidence of Tay-Sachs is 1/3,600 Ashkenazim births,what is the heterozygote (carrier) frequency?

A) 0.0003
B) 0.029
C) 0.286
D) 0.684
E) near 1.0

Related Questions

Q11: Mitochondrial DNA is helpful in obtaining a

Q12: DNA analysis to determine genetic identity applies A)

Q13: Which choice describes a biological population? A) a

Q14: VNTRs and STRs differ in that A) a

Q15: If one person in 50 is a

Q17: If the incidence of an autosomal recessive

Q18: Hardy-Weinberg equilibrium is possible only if the

Q19: Frequency of an X-linked recessive allele in

Q20: Principles of population genetics must be applied

Q21: The DNA sequence GATCTGATCTGATCTGATCT is a(n) A) VNTR. B)