Multiple Choice
Hardy-Weinberg equilibrium is possible only if the population is
A) small, with no migration out of in, and females outnumbering males.
B) large, with random mating and no migration, mutation, genetic drift, or natural selection.
C) small, with nonrandom mating and no migration, mutation, genetic drift, or artificial selection.
D) large, with nonrandom mating, mutation, genetic drift, and natural selection.
E) comprised of very young and fertile individuals and no newcomers arrive.
Correct Answer:
Verified
Correct Answer:
Verified
Q13: Which choice describes a biological population?<br>A) a
Q14: VNTRs and STRs differ in that<br>A) a
Q15: If one person in 50 is a
Q16: If the incidence of Tay-Sachs is 1/3,600
Q17: If the incidence of an autosomal recessive
Q19: Frequency of an X-linked recessive allele in
Q20: Principles of population genetics must be applied
Q21: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A) VNTR.<br>B)
Q22: Who invented DNA profiling?<br>A) Godfrey Hardy<br>B) William
Q23: A series of markers have the following