Multiple Choice
Principles of population genetics must be applied to determine identity based on DNA profiling because
A) VNTRs are not found in all populations.
B) individuals are their own populations.
C) random mating does not occur in all populations.
D) alleles are invariant between all human populations.
E) some populations may be too small to base conclusions.
Correct Answer:
Verified
Correct Answer:
Verified
Q15: If one person in 50 is a
Q16: If the incidence of Tay-Sachs is 1/3,600
Q17: If the incidence of an autosomal recessive
Q18: Hardy-Weinberg equilibrium is possible only if the
Q19: Frequency of an X-linked recessive allele in
Q21: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A) VNTR.<br>B)
Q22: Who invented DNA profiling?<br>A) Godfrey Hardy<br>B) William
Q23: A series of markers have the following
Q24: An autosomal recessive disorder strikes 1 in
Q25: A suspect's guilt seems highly likely when