Question 1

What percentage of DNA is non-coding information?

Accepted Answer

95%

Question 2

What is the representation for guanine?

Accepted Answer

A) Glu 
B) Gln 
C) G 
D) Gly 
A) Glu 
B) Gln 
C) G 
D) Gly C

Question 3

In what physical state do fats exist (as opposed to oils)?

Accepted Answer

As semi-solids

Question 4

How does one double bond affect the shape of a fatty acid?

Accepted Answer

A) It makes the molecule longer. 
B) It causes a bend in the molecule. 
C) It straightens the molecule. 
D) It has no effect on the shape. 
A) It makes the molecule longer. 
B) It causes a bend in the molecule. 
C) It straightens the molecule. 
D) It has no effect on the shape.

Question 5

What is a unit made of 20-50 amino acids called?

Accepted Answer

A) An oligopeptide 
B) A polysaccharide 
C) A polypeptide 
D) An oligosaccharide 
A) An oligopeptide 
B) A polysaccharide 
C) A polypeptide 
D) An oligosaccharide

Question 6

What would be a complementary strand of DNA for C-G-G-T-C-A?

Accepted Answer

A) C-G-G-A-G-T 
B) G-C-C-A-G-T 
C) G-C-C-T-G-A 
D) C-G-G-A-C-T 
A) C-G-G-A-G-T 
B) G-C-C-A-G-T 
C) G-C-C-T-G-A 
D) C-G-G-A-C-T

Question 7

Which of the following are inorganic ions found in fingerprints?

Accepted Answer

A) Na+, K+, Ca2+ 
B) Na+, K+, Ca+ 
C) K+, Cl-, Mg+ 
D) None of the above 
A) Na+, K+, Ca2+ 
B) Na+, K+, Ca+ 
C) K+, Cl-, Mg+ 
D) None of the above

Question 8

What do histidine, phenylalanine, and tyrosine all have in common?

Accepted Answer

A) They are all amino acids. 
B) They all contain a cyclic side chain. 
C) They are all monomers in proteins. 
D) All of the above 
A) They are all amino acids. 
B) They all contain a cyclic side chain. 
C) They are all monomers in proteins. 
D) All of the above

Question 9

$\begin{array}{l}
\text { TABLE 14.2 Nucleotide Code for Selected Amino Acids }\
\begin{array}{|lc|}
\hline \text { Amino Acid } \quad\quad\quad\quad\quad\quad\quad\quad& \text { Nucleotide Sequence } \
\hline \text { Alanine (Ala) } & \text { GCC } \
\text { Arginine (Arg) } & \text { CGC } \
\text { Asparagine (Asn) } & \text { AAC } \
\text { Aspartate (Asp) } & \text { GAC } \
\text { Glutamine (Gln) } & \text { CAA } \
\text { Glutamate (Glu) } & \text { GAA } \
\text { Glycine (Gly) } & \text { GGC } \
\text { Histidine (His) } & \text { CAC } \
\text { Lysine (Lys) } & \text { AAA } \
\text { Proline (Pro) } & \text { CCC } \
\text { Threonine (Thr) } & \text { ACC } \
\hline
\end{array}
\end{array}$
-What is the nucleotide sequence for Gly-His-Lys?

Accepted Answer

A) GGCCACCAA 
B) GCCCACAAA 
C) GGCAACAAA 
D) GGCCACAAA 
A) GGCCACCAA 
B) GCCCACAAA 
C) GGCAACAAA 
D) GGCCACAAA

Question 10

To what does the common term "sugar" apply?

Accepted Answer

A) Monosaccharides 
B) Disaccharides 
C) Both of the above 
D) None of the above 
A) Monosaccharides 
B) Disaccharides 
C) Both of the above 
D) None of the above

Question 11

What function does agrobacterium have in plants?

Accepted Answer

Agrobacter

Question 12

What is a complimentary DNA strand to T-G-C-C-A-T?

Accepted Answer

The answer of What is a complimentary DNA strand to...

Question 13

What living organisms share the genetic code?

Accepted Answer

A) All plants and animals excluding bacteria and one-cell organisms 
B) All plants exclusively 
C) All animals exclusively 
D) All living organisms 
A) All plants and animals excluding bacteria and one-cell organisms 
B) All plants exclusively 
C) All animals exclusively 
D) All living organisms

Question 14

Why are carbohydrates considered less polar than lipids?

Accepted Answer

A) Because carbohydrates have stronger intermolecular forces than lipids 
B) Because lipids have more -OH groups than carbohydrates 
C) Because lipids are generally cyclic molecules 
D) None of the above; carbohydrates are considered more polar than lipids. 
A) Because carbohydrates have stronger intermolecular forces than lipids 
B) Because lipids have more -OH groups than carbohydrates 
C) Because lipids are generally cyclic molecules 
D) None of the above; carbohydrates are considered more polar than lipids.

Question 15

Plant and animal waxes can be broken down into what two components?

Accepted Answer

A) A fatty acid and an inorganic ion 
B) A fatty acid and a semi-solid 
C) An alcohol and an oil 
D) An alcohol and a fatty acid 
A) A fatty acid and an inorganic ion 
B) A fatty acid and a semi-solid 
C) An alcohol and an oil 
D) An alcohol and a fatty acid

Question 16

Of the total population, what percentage will have both the TPOX 8,12 repeat, and the D16S539 9,9 repeat?

Accepted Answer

A) 0.0900% 
B) 0.0009% 
C) 0.0860% 
D) 0.0086% 
A) 0.0900% 
B) 0.0009% 
C) 0.0860% 
D) 0.0086%

Question 17

What animal sources besides sheep wool are used in fiber and textile production?

Accepted Answer

Camel hair, alpaca,

Question 18

What is the major, structural, molecular difference between cellulose and starch?

Accepted Answer

A) Humans can digest starch, but not cellulose. 
B) Humans can digest cellulose, but not starch. 
C) Cellulose units link in a linear manner, while starch links in an angular way. 
D) Starch units link in a linear manner, while cellulose links in an angular way. 
A) Humans can digest starch, but not cellulose. 
B) Humans can digest cellulose, but not starch. 
C) Cellulose units link in a linear manner, while starch links in an angular way. 
D) Starch units link in a linear manner, while cellulose links in an angular way.

Question 19

What does the abbreviation "DNA" stand for?

Accepted Answer

Deoxyribon

Question 20

$\begin{array}{l}
\text { TABLE 14.2 Nucleotide Code for Selected Amino Acids }\
\begin{array}{|lc|}
\hline \text { Amino Acid } \quad\quad\quad\quad\quad\quad\quad\quad& \text { Nucleotide Sequence } \
\hline \text { Alanine (Ala) } & \text { GCC } \
\text { Arginine (Arg) } & \text { CGC } \
\text { Asparagine (Asn) } & \text { AAC } \
\text { Aspartate (Asp) } & \text { GAC } \
\text { Glutamine (Gln) } & \text { CAA } \
\text { Glutamate (Glu) } & \text { GAA } \
\text { Glycine (Gly) } & \text { GGC } \
\text { Histidine (His) } & \text { CAC } \
\text { Lysine (Lys) } & \text { AAA } \
\text { Proline (Pro) } & \text { CCC } \
\text { Threonine (Thr) } & \text { ACC } \
\hline
\end{array}
\end{array}$
-The amino acid sequence Gly-His-Arg-Lys-Pro-Pro-Ala is made from what codon sequence?

Accepted Answer

A) GGCCACCGCTTTCCCCCCGCC 
B) CGCCACCGCAAACCCCCCGCC 
C) GGCCACCGCAAACCCCCCGCC 
D) GGCCACCGCAAACCCCCCGCG 
A) GGCCACCGCTTTCCCCCCGCC 
B) CGCCACCGCAAACCCCCCGCC 
C) GGCCACCGCAAACCCCCCGCC 
D) GGCCACCGCAAACCCCCCGCG

What percentage of DNA is non-coding information?

What is the representation for guanine?

In what physical state do fats exist (as opposed to oils)?

How does one double bond affect the shape of a fatty acid?

What is a unit made of 20-50 amino acids called?

What would be a complementary strand of DNA for C-G-G-T-C-A?

Which of the following are inorganic ions found in fingerprints?

What do histidine, phenylalanine, and tyrosine all have in common?

To what does the common term "sugar" apply?

What function does agrobacterium have in plants?

What is a complimentary DNA strand to T-G-C-C-A-T?

What living organisms share the genetic code?

Why are carbohydrates considered less polar than lipids?

Plant and animal waxes can be broken down into what two components?

Of the total population, what percentage will have both the TPOX 8,12 repeat, and the D16S539 9,9 repeat?

What animal sources besides sheep wool are used in fiber and textile production?

What is the major, structural, molecular difference between cellulose and starch?

What does the abbreviation "DNA" stand for?

Understanding Our World With Chemistry

Matter: Properties, Changes and Measurements

Understanding Atoms

Bonding and Reactions

Chemistry of Bonding: Structure and Function of Drug Molecules

Aqueous Solutions: Part I

Aqueous Solutions: Part II

Organic Chemistry and Polymers

Chemistry of Fire and Heat

Chemistry of Explosions

Applications of Chemical Kinetics

Nuclear Chemistry: Energy, Medicine, Weapons, and Terrorism

Chemical Equilibrium

Filters

Exam 14: Introduction to Biochemistry

What percentage of DNA is non-coding information?

What is the representation for guanine?

In what physical state do fats exist (as opposed to oils)?

How does one double bond affect the shape of a fatty acid?

What is a unit made of 20-50 amino acids called?

What would be a complementary strand of DNA for C-G-G-T-C-A?

Which of the following are inorganic ions found in fingerprints?

What do histidine, phenylalanine, and tyrosine all have in common?

To what does the common term "sugar" apply?

What function does agrobacterium have in plants?

What is a complimentary DNA strand to T-G-C-C-A-T?

What living organisms share the genetic code?

Why are carbohydrates considered less polar than lipids?

Plant and animal waxes can be broken down into what two components?

Of the total population, what percentage will have both the TPOX 8,12 repeat, and the D16S539 9,9 repeat?

What animal sources besides sheep wool are used in fiber and textile production?

What is the major, structural, molecular difference between cellulose and starch?

What does the abbreviation "DNA" stand for?

Understanding Our World With Chemistry

Matter: Properties, Changes and Measurements

Understanding Atoms

Bonding and Reactions

Chemistry of Bonding: Structure and Function of Drug Molecules

Aqueous Solutions: Part I

Aqueous Solutions: Part II

Organic Chemistry and Polymers

Chemistry of Fire and Heat

Chemistry of Explosions

Applications of Chemical Kinetics

Nuclear Chemistry: Energy, Medicine, Weapons, and Terrorism

Chemical Equilibrium

Filters