Solved

VNTRs and STRs Differ in That

Question 15

Multiple Choice

VNTRs and STRs differ in that


A) a VNTR repeat is shorter than an STR repeat.
B) a VNTR repeat is longer than an STR repeat.
C) a VNTR is a type of copy number variant and an STR is not.
D) an STR is a type of copy number variant and a VNTR is not.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q10: For a very rare inherited disease,the frequency

Q11: Hardy-Weinberg equilibrium is possible only if the

Q12: Which group is used to calculate the

Q13: Which of the following have the longest

Q14: Who invented DNA profiling?<br>A)Godfrey Hardy<br>B)William Weinberg<br>C)Sir Alec

Q16: Familial DNA search was used in the

Q17: Combined DNA Index System (CODIS)is<br>A)a fifteen-base DNA

Q18: DNA analysis to determine genetic identity applies<br>A)Mendel's

Q19: Frequency of an X-linked recessive allele in

Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.