Solved

Combined DNA Index System (CODIS)is

Question 17

Multiple Choice

Combined DNA Index System (CODIS) is


A) a fifteen-base DNA sequence used in DNA profiling.
B) a type of mutation used in forensic applications.
C) a system for crime laboratories to share DNA profiles.
D) a technology used to amplify DNA found at crime scenes.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q12: Which group is used to calculate the

Q13: Which of the following have the longest

Q14: Who invented DNA profiling?<br>A)Godfrey Hardy<br>B)William Weinberg<br>C)Sir Alec

Q15: VNTRs and STRs differ in that<br>A)a VNTR

Q16: Familial DNA search was used in the

Q18: DNA analysis to determine genetic identity applies<br>A)Mendel's

Q19: Frequency of an X-linked recessive allele in

Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.

Q21: The allele T is in 85 percent

Q22: If the incidence of an autosomal recessive