Solved

Frequency of an X-Linked Recessive Allele in Males Equals

Question 19

Multiple Choice

Frequency of an X-linked recessive allele in males equals


A) p2.
B) 2pq.
C) q2.
D) q.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q14: Who invented DNA profiling?<br>A)Godfrey Hardy<br>B)William Weinberg<br>C)Sir Alec

Q15: VNTRs and STRs differ in that<br>A)a VNTR

Q16: Familial DNA search was used in the

Q17: Combined DNA Index System (CODIS)is<br>A)a fifteen-base DNA

Q18: DNA analysis to determine genetic identity applies<br>A)Mendel's

Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.

Q21: The allele T is in 85 percent

Q22: If the incidence of an autosomal recessive

Q23: In the Hardy-Weinberg equation,2pq refers to<br>A)the proportion

Q24: In order to identify (or rule out