Multiple Choice
DNA analysis to determine genetic identity applies
A) Mendel's law of independent assortment and the product rule.
B) Mendel's law of segregation and the product rule.
C) the law of polymorphism.
D) Darwin's mathematical principles.
Correct Answer:
Verified
Correct Answer:
Verified
Q13: Which of the following have the longest
Q14: Who invented DNA profiling?<br>A)Godfrey Hardy<br>B)William Weinberg<br>C)Sir Alec
Q15: VNTRs and STRs differ in that<br>A)a VNTR
Q16: Familial DNA search was used in the
Q17: Combined DNA Index System (CODIS)is<br>A)a fifteen-base DNA
Q19: Frequency of an X-linked recessive allele in
Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.
Q21: The allele T is in 85 percent
Q22: If the incidence of an autosomal recessive
Q23: In the Hardy-Weinberg equation,2pq refers to<br>A)the proportion