menu-iconExamlexExamLexServices

Discover

Ask a Question
  1. All Topics
  2. Topic
    Biology
  3. Study Set
    Human Genetics Study Set 1
  4. Exam
    Exam 14: Constant Allele Frequencies
  5. Question
    DNA Analysis to Determine Genetic Identity Applies
Solved

DNA Analysis to Determine Genetic Identity Applies

Question 18

Question 18

Multiple Choice

DNA analysis to determine genetic identity applies


A) Mendel's law of independent assortment and the product rule.
B) Mendel's law of segregation and the product rule.
C) the law of polymorphism.
D) Darwin's mathematical principles.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q13: Which of the following have the longest

Q14: Who invented DNA profiling?<br>A)Godfrey Hardy<br>B)William Weinberg<br>C)Sir Alec

Q15: VNTRs and STRs differ in that<br>A)a VNTR

Q16: Familial DNA search was used in the

Q17: Combined DNA Index System (CODIS)is<br>A)a fifteen-base DNA

Q19: Frequency of an X-linked recessive allele in

Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.

Q21: The allele T is in 85 percent

Q22: If the incidence of an autosomal recessive

Q23: In the Hardy-Weinberg equation,2pq refers to<br>A)the proportion

Examlex

ExamLex

About UsContact UsPerks CenterHomeschoolingTest Prep

Work With Us

Campus RepresentativeInfluencers

Links

FaqPricingChrome Extension

Download The App

Get App StoreGet Google Play

Policies

Privacy PolicyTerms of ServiceHonor CodeCommunity Guidelines

Scan To Download

qr-code

Copyright © (2025) ExamLex LLC.

Privacy PolicyTerms Of ServiceHonor CodeCommunity Guidelines