Question 1

Which statement about mRNA stability is TRUE?

Accepted Answer

A)  Degradation always proceeds in the 5' to 3' direction. 
B)  Degradation of mRNA by polynucleotide phosphorylase yields 5'-nucleoside monophosphates. 
C)  In general, bacterial mRNAs have longer half-lives than do eukaryotic mRNAs. 
D)  Rates of mRNA degradation are always at least 10-fold slower than rates of mRNA synthesis. 
E)  Secondary structure in mRNA (hairpins, for example) slows the rate of degradation. 
A)  Degradation always proceeds in the 5' to 3' direction. 
B)  Degradation of mRNA by polynucleotide phosphorylase yields 5'-nucleoside monophosphates. 
C)  In general, bacterial mRNAs have longer half-lives than do eukaryotic mRNAs. 
D)  Rates of mRNA degradation are always at least 10-fold slower than rates of mRNA synthesis. 
E)  Secondary structure in mRNA (hairpins, for example) slows the rate of degradation. E

Question 2

Which statement does NOT describe the CAP structure of mRNA?

Accepted Answer

A)  The CAP structure contains two phosphoanhydride bonds. 
B)  The CAP is added to an existing 5'triphosphate nucleotide. 
C)  The CAP structure may include multiple methylations. 
D)  The CAP structure is added after addition of the poly(
A)  structure. 
E)  The CAP interacts with both the ribosome and the carboxyterminal domain of RNA Pol II. 
A)  The CAP structure contains two phosphoanhydride bonds. 
B)  The CAP is added to an existing 5'triphosphate nucleotide. 
C)  The CAP structure may include multiple methylations. 
D)  The CAP structure is added after addition of the poly(
A)  structure. 
E)  The CAP interacts with both the ribosome and the carboxyterminal domain of RNA Pol II. D

Question 3

Which factor is NOT known to be involved in initiation by eukaryotic RNA polymerase II?

Accepted Answer

A)  DNA helicase activity 
B)  DNA polymerase activity 
C)  formation of an open complex 
D)  protein binding to specific DNA sequences 
E)  protein phosphorylation 
A)  DNA helicase activity 
B)  DNA polymerase activity 
C)  formation of an open complex 
D)  protein binding to specific DNA sequences 
E)  protein phosphorylation B

Question 4

A branched ("lariat") structure is formed during:

Accepted Answer

A)  attachment of a 5' cap to mRNA. 
B)  attachment of poly(
A)  tails to mRNA. 
C)  processing of preribosomal RNA. 
D)  splicing of all classes of introns. 
E)  splicing of group II introns. 
A)  attachment of a 5' cap to mRNA. 
B)  attachment of poly(
A)  tails to mRNA. 
C)  processing of preribosomal RNA. 
D)  splicing of all classes of introns. 
E)  splicing of group II introns.

Question 5

Define ribozymes and briefly describe the structure and function of two ribozymes.

Accepted Answer

Ribozymes are RNA molecules that have ca

Question 6

The specific sequences that E. coli RNA polymerase usually binds to in E. coli DNA before initiating transcription generally contain more A=T base pairs than G$ \equiv$C base pairs. In no more than a few sentences, speculate on why this might be the case.

Accepted Answer

One possible reason for this could be th

Question 7

Which factor is NOT usually essential for the catalytic activity of ribozymes?

Accepted Answer

A)  correct base pairing 
B)  correct base sequence 
C)  correct interaction with protein 
D)  correct secondary structure 
E)  correct three-dimensional structure 
A)  correct base pairing 
B)  correct base sequence 
C)  correct interaction with protein 
D)  correct secondary structure 
E)  correct three-dimensional structure

Question 8

Which statement is TRUE regarding the TATA box in transcription?

Accepted Answer

A)  It is involved in binding the $\sigma$ subunit in E. coli transcription. 
B)  It is found at position -10 relative to the transcription start site. 
C)  It is a site for assembly of the preinitiation complex. 
D)  It is a site for binding of repressor proteins. 
E)  All of the statements are true. 
A)  It is involved in binding the $\sigma$ subunit in E. coli transcription. 
B)  It is found at position -10 relative to the transcription start site. 
C)  It is a site for assembly of the preinitiation complex. 
D)  It is a site for binding of repressor proteins. 
E)  All of the statements are true.

Question 9

Aptamers are:

Accepted Answer

A)  double-stranded RNA products of nuclease action on hairpin RNAs. 
B)  repeat sequence elements at the ends of transposons. 
C)  small RNA molecules selected for tight binding to specific molecular targets. 
D)  the RNA primers required for retroviral replication. 
E)  the short tandem repeat units found in telomeres. 
A)  double-stranded RNA products of nuclease action on hairpin RNAs. 
B)  repeat sequence elements at the ends of transposons. 
C)  small RNA molecules selected for tight binding to specific molecular targets. 
D)  the RNA primers required for retroviral replication. 
E)  the short tandem repeat units found in telomeres.

Question 10

Which statement is NOT true of the mRNA for calcitonin?

Accepted Answer

A)  Exons are used for polypeptide synthesis. 
B)  Introns are complementary to their adjacent exons and will form hybrids with them. 
C)  The mature mRNA is substantially shorter than the corresponding region on the DNA. 
D)  The mRNA is originally synthesized in the nucleus, but ends up in the cytoplasm. 
E)  The splicing that yields a mature mRNA occurs at very specific sites in the RNA primary transcript. 
A)  Exons are used for polypeptide synthesis. 
B)  Introns are complementary to their adjacent exons and will form hybrids with them. 
C)  The mature mRNA is substantially shorter than the corresponding region on the DNA. 
D)  The mRNA is originally synthesized in the nucleus, but ends up in the cytoplasm. 
E)  The splicing that yields a mature mRNA occurs at very specific sites in the RNA primary transcript.

Question 11

Which characteristic does NOT apply to the $\rho$-terminator in E. coli?

Accepted Answer

A)  The $\rho$-terminator has an ATP-dependent RNA-DNA helicase activity. 
B)  The $\rho$-terminator migrates in the 3'-5' direction along RNA. 
C)  The $\rho$-terminator causes RNA polymerase release at a CA-rich sequence near the end of the transcript. 
D)  ATP is hydrolyzed by the $\rho$-terminator during the termination process. 
E)  All of these characteristics apply to the $\rho$-terminator. 
A)  The $\rho$-terminator has an ATP-dependent RNA-DNA helicase activity. 
B)  The $\rho$-terminator migrates in the 3'-5' direction along RNA. 
C)  The $\rho$-terminator causes RNA polymerase release at a CA-rich sequence near the end of the transcript. 
D)  ATP is hydrolyzed by the $\rho$-terminator during the termination process. 
E)  All of these characteristics apply to the $\rho$-terminator.

Question 12

The DNA molecule below is believed to contain a binding site for protein X. It is labeled at the 5' end of the top strand (*), then subjected to a footprinting experiment. In the idealized gel below, there is a band for every base of the labeled strand. On the DNA sequence, point out the binding site for protein X.
*(5')GGATTCTAATAAAGTAACGCGTTACGACTTGG
CCTAAGATTATTTCATTGCGCAATGCTGAACC   [

Accepted Answer

The answer of The DNA molecule below is believed to...

Question 13

Splicing of introns in nuclear mRNA primary transcripts requires:

Accepted Answer

A)  a guanine nucleoside or nucleotide. 
B)  endoribonucleases. 
C)  polynucleotide phosphorylase. 
D)  RNA polymerase II. 
E)  small nuclear ribonucleoproteins (snRNPs). 
A)  a guanine nucleoside or nucleotide. 
B)  endoribonucleases. 
C)  polynucleotide phosphorylase. 
D)  RNA polymerase II. 
E)  small nuclear ribonucleoproteins (snRNPs).

Question 14

In 1989, Sidney Altman won a Nobel Prize for his work on RNase P. In no more than three sentences, describe the function of RNase P, as well as the unusual characteristic of this enzyme that made Altman's work so important.

Accepted Answer

RNase P is an enzyme responsible for cle

Question 15

E. coli RNA polymerase (RNAP) has no 3' to 5' exonuclease activity. Which statement BEST explains why this is not a required activity for this enzyme?

Accepted Answer

A)  RNAP makes fewer errors in NTP addition, so this activity is unnecessary. 
B)  RNAP does not need to degrade nucleic acids ahead of the transcription bubble. 
C)  Errors in transcription will have no impact on the function of the RNA product. 
D)  Multiple RNA products are created and turnover rapidly, so errors have less impact. 
E)  None of the statements explains why this is not a required activity. 
A)  RNAP makes fewer errors in NTP addition, so this activity is unnecessary. 
B)  RNAP does not need to degrade nucleic acids ahead of the transcription bubble. 
C)  Errors in transcription will have no impact on the function of the RNA product. 
D)  Multiple RNA products are created and turnover rapidly, so errors have less impact. 
E)  None of the statements explains why this is not a required activity.

Question 16

Which property of the L-19 IVS ribozyme is NOT shared with enzymes that are purely protein?

Accepted Answer

A)  It acts as a true catalyst. 
B)  It can be competitively inhibited. 
C)  It displays Michaelis-Menten kinetics. 
D)  It exploits base pairing with internal guide sequences. 
E)  It makes use of covalent and metal ion catalysis. 
A)  It acts as a true catalyst. 
B)  It can be competitively inhibited. 
C)  It displays Michaelis-Menten kinetics. 
D)  It exploits base pairing with internal guide sequences. 
E)  It makes use of covalent and metal ion catalysis.

Question 17

Explain why splicesosomal introns likely evolved from group II introns and not group I introns.

Accepted Answer

Splicesosomal introns likely evolved fro

Question 18

Describe briefly the process of initiation by eukaryotic RNA polymerase.

Accepted Answer

The process of initiation by eukaryotic

Question 19

For each of the following statements, indicate with a P if the statement applies only to prokaryotes, an E if the statement applies only to eukaryotes, and an E and P if the statement applies to both eukaryotes and prokaryotes.
___ RNA synthesis is blocked by actinomycin D.
___ A single RNA polymerase transcribes genes that encode mRNAs, tRNAs, and rRNA.
___ Transcription of mRNA is blocked by $\alpha$-amanitin.
___ Sigma ($\sigma$) subunit detaches from RNA polymerase shortly after transcription has initiated.
___ The 5' end of the mature mRNA begins with a triphosphate.
___ The primary mRNA transcript is inactive.
___ Termination of transcription requires the protein $\rho$factor.

Accepted Answer

Here are the answers to the statements w

Question 20

Which structure is NOT a folded RNA structure?

Accepted Answer

A)  tRNA 
B)  a riboswitch 
C)  a group II intron 
D)  U2 snRNA 
E)  All of these are folded RNA structures. 
A)  tRNA 
B)  a riboswitch 
C)  a group II intron 
D)  U2 snRNA 
E)  All of these are folded RNA structures.

Exam 26: RNA Metabolism

Which statement about mRNA stability is TRUE?

Which statement does NOT describe the CAP structure of mRNA?

Which factor is NOT known to be involved in initiation by eukaryotic RNA polymerase II?

A branched ("lariat") structure is formed during:

Define ribozymes and briefly describe the structure and function of two ribozymes.

The specific sequences that E. coli RNA polymerase usually binds to in E. coli DNA before initiating transcription generally contain more A=T base pairs than G ≡ \equiv≡ C base pairs. In no more than a few sentences, speculate on why this might be the case.

Which factor is NOT usually essential for the catalytic activity of ribozymes?

Which statement is TRUE regarding the TATA box in transcription?

Aptamers are:

Which statement is NOT true of the mRNA for calcitonin?

Which characteristic does NOT apply to the ρ\rhoρ -terminator in E. coli?

Splicing of introns in nuclear mRNA primary transcripts requires:

In 1989, Sidney Altman won a Nobel Prize for his work on RNase P. In no more than three sentences, describe the function of RNase P, as well as the unusual characteristic of this enzyme that made Altman's work so important.

E. coli RNA polymerase (RNAP) has no 3' to 5' exonuclease activity. Which statement BEST explains why this is not a required activity for this enzyme?

Which property of the L-19 IVS ribozyme is NOT shared with enzymes that are purely protein?

Explain why splicesosomal introns likely evolved from group II introns and not group I introns.

Describe briefly the process of initiation by eukaryotic RNA polymerase.

Which structure is NOT a folded RNA structure?

The Foundations of Biochemistry

Water

Amino Acids, Peptides, and Proteins

The Three-Dimensional Structure of Proteins

Protein Function

Enzymes

Carbohydrates and Glycobiology

Nucleotides and Nucleic Acids

DNA-Based Information Technologies

Lipids

Biological Membranes and Transport

Biosignaling

Bioenergetics and Biochemical Reaction Types

Glycolysis, Gluconeogenesis, and the Pentose Phosphate Pathway

Principles of Metabolic Regulation

The Citric Acid Cycle

Fatty Acid Catabolism

Amino Acid Oxidation and the Production of Urea

Oxidative Phosphorylation and Photophosphorylation

Carbohydrate Biosynthesis in Plants and Bacteria

Lipid Biosynthesis

Biosynthesis of Amino Acids, Nucleotides, and Related Molecules

Hormonal Regulation and Integration of Mammalian Metabolism

Genes and Chromosomes

DNA Metabolism

Protein Metabolism

Regulation of Gene Expression

Filters

The specific sequences that E. coli RNA polymerase usually binds to in E. coli DNA before initiating transcription generally contain more A=T base pairs than G $\equiv$ C base pairs. In no more than a few sentences, speculate on why this might be the case.

Which characteristic does NOT apply to the $\rho$ -terminator in E. coli?