Solved

In Order to Identify (Or Rule Out Identity)from a DNA

Question 24

Multiple Choice

In order to identify (or rule out identity) from a DNA sample that is a mixture,the investigator should know


A) how long the DNA has been exposed to the environment.
B) how the person perished.
C) the population groups to which the person of interest belongs or belonged.
D) the genome sequence of the suspect or missing person.

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q19: Frequency of an X-linked recessive allele in

Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.

Q21: The allele T is in 85 percent

Q22: If the incidence of an autosomal recessive

Q23: In the Hardy-Weinberg equation,2pq refers to<br>A)the proportion

Q25: Tay-Sachs disease affects in 1 in 3,600

Q26: Familial DNA searches are controversial since innocent

Q27: Principles of population genetics must be applied

Q28: In a population in Hardy-Weinberg equilibrium,the frequency

Q29: In a population in Hardy-Weinberg equilibrium,frequency of