Solved

The Allele T Is in 85 Percent of a Population

Question 21

Multiple Choice

The allele T is in 85 percent of a population (p=0.85) .According to the Hardy-Weinberg equation,what percentage of the population will have the recessive allele t (q=?) ?


A) 15%
B) 50%
C) 85%
D) 0%

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q16: Familial DNA search was used in the

Q17: Combined DNA Index System (CODIS)is<br>A)a fifteen-base DNA

Q18: DNA analysis to determine genetic identity applies<br>A)Mendel's

Q19: Frequency of an X-linked recessive allele in

Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.

Q22: If the incidence of an autosomal recessive

Q23: In the Hardy-Weinberg equation,2pq refers to<br>A)the proportion

Q24: In order to identify (or rule out

Q25: Tay-Sachs disease affects in 1 in 3,600

Q26: Familial DNA searches are controversial since innocent