Solved

If the Incidence of an Autosomal Recessive Condition Is 1/3600

Question 22

Multiple Choice

If the incidence of an autosomal recessive condition is 1/3600 live births,what is the carrier frequency?


A) 0.0003
B) 0.029
C) 0.286
D) 0.684

Correct Answer:

verifed

Verified

Unlock this answer now
Get Access to more Verified Answers free of charge

Related Questions

Q17: Combined DNA Index System (CODIS)is<br>A)a fifteen-base DNA

Q18: DNA analysis to determine genetic identity applies<br>A)Mendel's

Q19: Frequency of an X-linked recessive allele in

Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.

Q21: The allele T is in 85 percent

Q23: In the Hardy-Weinberg equation,2pq refers to<br>A)the proportion

Q24: In order to identify (or rule out

Q25: Tay-Sachs disease affects in 1 in 3,600

Q26: Familial DNA searches are controversial since innocent

Q27: Principles of population genetics must be applied