Multiple Choice
In the Hardy-Weinberg equation,2pq refers to
A) the proportion of heterozygotes in a population.
B) the number of homozygous dominant individuals in a population.
C) the most common phenotype in a population.
D) individuals who are homozygous recessive.
Correct Answer:
Verified
Correct Answer:
Verified
Q18: DNA analysis to determine genetic identity applies<br>A)Mendel's
Q19: Frequency of an X-linked recessive allele in
Q20: The DNA sequence GATCTGATCTGATCTGATCT is a(n)<br>A)VNTR.<br>B)STR.<br>C)RFLP.<br>D)SNP.
Q21: The allele T is in 85 percent
Q22: If the incidence of an autosomal recessive
Q24: In order to identify (or rule out
Q25: Tay-Sachs disease affects in 1 in 3,600
Q26: Familial DNA searches are controversial since innocent
Q27: Principles of population genetics must be applied
Q28: In a population in Hardy-Weinberg equilibrium,the frequency