Question 1

How many STRs are typically used to create a profile in forensic investigations?

Accepted Answer

A)  10 
B)  2 
C)  5 
D)  15 
E)  25 
A)  10 
B)  2 
C)  5 
D)  15 
E)  25 D

Question 2

DNA is made of the following nucleotide bases,EXCEPT

Accepted Answer

A)  adenine. 
B)  guanine. 
C)  phosphate. 
D)  cytosine. 
E)  thymine. 
A)  adenine. 
B)  guanine. 
C)  phosphate. 
D)  cytosine. 
E)  thymine. C

Question 3

What is meant by "semiconservative" replication?

Accepted Answer

A)  As the new strands of DNA are formed,the old strands are broken down and recycled. 
B)  As the new strands of DNA are formed,one of the old strands is broken down and recycled while the other is used as a template for the creation of a new strand. 
C)  The original strands of DNA are used to make newer strands,resulting in two copies of the DNA,one made entirely of new DNA,the other entirely of old DNA. 
D)  As DNA replication occurs,two new strands of DNA are produced without use of the original strands. 
E)  Each newly replicated strand of DNA consists of one original strand and one newly formed strand. 
A)  As the new strands of DNA are formed,the old strands are broken down and recycled. 
B)  As the new strands of DNA are formed,one of the old strands is broken down and recycled while the other is used as a template for the creation of a new strand. 
C)  The original strands of DNA are used to make newer strands,resulting in two copies of the DNA,one made entirely of new DNA,the other entirely of old DNA. 
D)  As DNA replication occurs,two new strands of DNA are produced without use of the original strands. 
E)  Each newly replicated strand of DNA consists of one original strand and one newly formed strand. E

Question 4

Which person would have DNA that is least similar to yours?

Accepted Answer

A)  your mother 
B)  your mother's brother 
C)  your older sibling 
D)  your identical twin 
E)  your nonidentical twin 
A)  your mother 
B)  your mother's brother 
C)  your older sibling 
D)  your identical twin 
E)  your nonidentical twin

Question 5

Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12:
Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC
Bob: TTCGTTCCCAGCTAGCTTAACCGGC
Which of the following accurately compares Mary and Bob's DNA?

Accepted Answer

A)  Mary and Bob are most likely fraternal twins. 
B)  Mary has five STRs at this site;Bob has two. 
C)  Mary has one STR at this site;Bob has none. 
D)  The DNA shown must be from the 23rd chromosome,not the 12th. 
E)  None of the above. 
A)  Mary and Bob are most likely fraternal twins. 
B)  Mary has five STRs at this site;Bob has two. 
C)  Mary has one STR at this site;Bob has none. 
D)  The DNA shown must be from the 23rd chromosome,not the 12th. 
E)  None of the above.

Question 6

Which of the following is a nucleotide?

Accepted Answer

A)  polymerase 
B)  guanine 
C)  phosphate 
D)  DNA 
E)  STR region 
A)  polymerase 
B)  guanine 
C)  phosphate 
D)  DNA 
E)  STR region

Question 7

Whose DNA will be most similar to Bob's? Arrange them in order,from most similar to least similar: mother,sibling,grandfather,identical twin.

Accepted Answer

A)  identical twin,mother,sibling,grandfather 
B)  grandfather,sibling,mother,identical twin 
C)  mother,sibling,identical twin,grandfather 
D)  identical twin,sibling,grandfather,mother 
E)  none of the above 
A)  identical twin,mother,sibling,grandfather 
B)  grandfather,sibling,mother,identical twin 
C)  mother,sibling,identical twin,grandfather 
D)  identical twin,sibling,grandfather,mother 
E)  none of the above

Question 8

Red blood cells go through some special modifications as they mature.As a final step,the cells lose their nucleus.Which of the following is a likely consequence?

Accepted Answer

A)  Red blood cells have extra genes not found in other cells. 
B)  Red blood cells have less DNA than other cells. 
C)  Red blood cells have less carbohydrate than other cells. 
D)  Red blood cells have more DNA than other cells. 
E)  Red blood cells are larger than most other cells. 
A)  Red blood cells have extra genes not found in other cells. 
B)  Red blood cells have less DNA than other cells. 
C)  Red blood cells have less carbohydrate than other cells. 
D)  Red blood cells have more DNA than other cells. 
E)  Red blood cells are larger than most other cells.

Question 9

How is the structure of a DNA molecule arranged?

Accepted Answer

A)  Each nucleotide's phosphate group binds to the corresponding phosphate group of another nucleotide. 
B)  Each nucleotide's sugar group binds to the corresponding sugar group of another nucleotide. 
C)  Each nucleotide's phosphate group binds to the sugar group of the next nucleotide. 
D)  Each nucleotide's base binds to the next nucleotide base. 
E)  Each nucleotide's base binds to the phosphate group of another nucleotide. 
A)  Each nucleotide's phosphate group binds to the corresponding phosphate group of another nucleotide. 
B)  Each nucleotide's sugar group binds to the corresponding sugar group of another nucleotide. 
C)  Each nucleotide's phosphate group binds to the sugar group of the next nucleotide. 
D)  Each nucleotide's base binds to the next nucleotide base. 
E)  Each nucleotide's base binds to the phosphate group of another nucleotide.

Question 10

In addition to the base,what are the other components of a nucleotide?

Accepted Answer

A)  sugar and polymerase 
B)  phosphate group and sugar 
C)  phosphate group and polymerase 
D)  phosphate group and helix 
E)  helix and sugar 
A)  sugar and polymerase 
B)  phosphate group and sugar 
C)  phosphate group and polymerase 
D)  phosphate group and helix 
E)  helix and sugar

Question 11

DNA can be visualized as a ladder.Which parts would be the rungs (where you step)and which would be the stringers (the sides where you hold on)?

Accepted Answer

A)  The sugars and bases are rungs,and the phosphates are stringers. 
B)  The phosphates and bases are rungs,and the sugars are stringers. 
C)  The H-bonded sugars are rungs,and the phosphate bases are stringers. 
D)  The bases are rungs,and the sugars and phosphates are stringers. 
E)  The bases are the rungs,and the sugars the stringers. 
A)  The sugars and bases are rungs,and the phosphates are stringers. 
B)  The phosphates and bases are rungs,and the sugars are stringers. 
C)  The H-bonded sugars are rungs,and the phosphate bases are stringers. 
D)  The bases are rungs,and the sugars and phosphates are stringers. 
E)  The bases are the rungs,and the sugars the stringers.

Question 12

The width (diameter)of the DNA helix normally varies a lot,depending on which bases are paired together at that location.

Accepted Answer

A)  True 
B)  False 
A)  True 
B)  False

Question 13

DNA evidence can give an investigator information regarding which of the following?

Accepted Answer

A)  family relationships between suspects 
B)  identity of an individual based on a profile 
C)  locations of an individual 
D)  family relationships between suspects and the locations of an individual 
E)  family relationships between suspects and the identity of an individual based on a profile 
A)  family relationships between suspects 
B)  identity of an individual based on a profile 
C)  locations of an individual 
D)  family relationships between suspects and the locations of an individual 
E)  family relationships between suspects and the identity of an individual based on a profile

Question 14

Identify the correct nucleotide base pairing.

Accepted Answer

A)  A-C;G-T 
B)  A-G;C-T 
C)  A-T;G-C 
D)  A-A;T-T 
E)  A-G;A-C 
A)  A-C;G-T 
B)  A-G;C-T 
C)  A-T;G-C 
D)  A-A;T-T 
E)  A-G;A-C

Question 15

What naturally occurring process does PCR mimic in a test tube?

Accepted Answer

A)  DNA condensation 
B)  transcription 
C)  genomics 
D)  DNA replication 
E)  polymerization 
A)  DNA condensation 
B)  transcription 
C)  genomics 
D)  DNA replication 
E)  polymerization

Question 16

STRs are

Accepted Answer

A)  found only on chromosome 7. 
B)  in the coding regions only of all chromosomes. 
C)  the same on every chromosome. 
D)  in the noncoding regions of all chromosomes. 
E)  in the noncoding regions of some chromosomes. 
A)  found only on chromosome 7. 
B)  in the coding regions only of all chromosomes. 
C)  the same on every chromosome. 
D)  in the noncoding regions of all chromosomes. 
E)  in the noncoding regions of some chromosomes.

Question 17

The gel at right shows the DNA profiles for several individuals.If A is the mother and B is the father,which one of the others could be their child?

Accepted Answer

A)  C 
B)  D 
C)  E 
D)  C,D,and E 
E)  None of the above. 
A)  C 
B)  D 
C)  E 
D)  C,D,and E 
E)  None of the above.

Question 18

Some highly degraded DNA was collected from a crime scene.Upon analysis,forensic scientists were only able to accurately sequence one 450-nucleotide-long segment of DNA from a Y chromosome.There are five suspects in the case,but they have fled the state.However,they all have large extended families in the area.How can the police narrow the search to just one suspect?

Accepted Answer

A)  Collect DNA from male siblings,fathers,or paternal grandfathers. 
B)  Collect DNA from sisters,mothers,and maternal grandmothers. 
C)  Collect DNA from any male relatives on the mother's or father's side. 
D)  Collect DNA from any female relatives on the mother's or father's side. 
E)  Collect DNA from any available blood relatives of any gender. 
A)  Collect DNA from male siblings,fathers,or paternal grandfathers. 
B)  Collect DNA from sisters,mothers,and maternal grandmothers. 
C)  Collect DNA from any male relatives on the mother's or father's side. 
D)  Collect DNA from any female relatives on the mother's or father's side. 
E)  Collect DNA from any available blood relatives of any gender.

Question 19

What is the significance of STRs in DNA profiling?

Accepted Answer

A)  STRs vary among different tissues within an individual,so they can be used to determine which organ was the source of the DNA. 
B)  STRs are inherited from only maternal DNA and can track parentage. 
C)  STRs are inherited from only paternal DNA and can track parentage. 
D)  STRs vary in length from person to person,which helps to identify specific individuals. 
E)  STRs code for proteins,therefore they are highly variable among individuals and can help to identify specific individuals. 
A)  STRs vary among different tissues within an individual,so they can be used to determine which organ was the source of the DNA. 
B)  STRs are inherited from only maternal DNA and can track parentage. 
C)  STRs are inherited from only paternal DNA and can track parentage. 
D)  STRs vary in length from person to person,which helps to identify specific individuals. 
E)  STRs code for proteins,therefore they are highly variable among individuals and can help to identify specific individuals.

Question 20

You are hired as a research assistant to help determine the genome of a wild onion plant.At the end of this project,you expect to have the

Accepted Answer

A)  sequence of all of its genes. 
B)  sequence of all of its DNA. 
C)  sequence of all of its proteins. 
D)  total amount of RNA,DNA,and protein in its cells. 
E)  number of chromosomes in its nucleus. 
A)  sequence of all of its genes. 
B)  sequence of all of its DNA. 
C)  sequence of all of its proteins. 
D)  total amount of RNA,DNA,and protein in its cells. 
E)  number of chromosomes in its nucleus.

Exam 7: DNA Structure and Replication

How many STRs are typically used to create a profile in forensic investigations?

DNA is made of the following nucleotide bases,EXCEPT

What is meant by "semiconservative" replication?

Which person would have DNA that is least similar to yours?

Here are noncoding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12: Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC Bob: TTCGTTCCCAGCTAGCTTAACCGGC Which of the following accurately compares Mary and Bob's DNA?

Which of the following is a nucleotide?

Whose DNA will be most similar to Bob's? Arrange them in order,from most similar to least similar: mother,sibling,grandfather,identical twin.

Red blood cells go through some special modifications as they mature.As a final step,the cells lose their nucleus.Which of the following is a likely consequence?

How is the structure of a DNA molecule arranged?

In addition to the base,what are the other components of a nucleotide?

DNA can be visualized as a ladder.Which parts would be the rungs (where you step)and which would be the stringers (the sides where you hold on)?

The width (diameter)of the DNA helix normally varies a lot,depending on which bases are paired together at that location.

DNA evidence can give an investigator information regarding which of the following?

Identify the correct nucleotide base pairing.

What naturally occurring process does PCR mimic in a test tube?

STRs are

The gel at right shows the DNA profiles for several individuals.If A is the mother and B is the father,which one of the others could be their child?

What is the significance of STRs in DNA profiling?

You are hired as a research assistant to help determine the genome of a wild onion plant.At the end of this project,you expect to have the

Process of Science

Chemistry of Life

Cell Structure and Function

Nutrition, Enzymes, Metabolism

Energy and Photosynthesis

Dietary Energy and Cellular Respiration

Genes to Proteins

Cell Cycle and Cell Differentiation

Mutations and Cancer

Simple Inheritance and Meiosis

Complex Inheritance

Natural Selection and Adaptation

Nonadaptive Evolution and Speciation

Evidence for Evolution

Life on Earth

Prokaryotic Diversity

Eukaryotic Diversity

Human Evolution

Population Ecology

Community Ecology

Ecosystem Ecology

Sustainability

Plant Growth and Reproduction

Plant Physiology

Overview of Physiology

Digestive System

Cardiovascular System

Respiratory System

Central Nervous System

Reproductive System

Immune System

A Range of Biology

Filters