Question 1

Which of the following is NOT true about protein structure?

Accepted Answer

A)  A protein's tertiary structure is ultimately determined by its primary amino acid sequence. 
B)  An alpha helix is an example of tertiary structure. 
C)  Tertiary structure may be stabilized by hydrogen bonds, disulfide bonds, ionic bridges, and van der Waals interactions 
D)  Enzymes such as lysozyme have tertiary structure. 
A)  A protein's tertiary structure is ultimately determined by its primary amino acid sequence. 
B)  An alpha helix is an example of tertiary structure. 
C)  Tertiary structure may be stabilized by hydrogen bonds, disulfide bonds, ionic bridges, and van der Waals interactions 
D)  Enzymes such as lysozyme have tertiary structure. B

Question 2

Compare and contrast the overall shape and function of globular, fibrous, and membrane proteins. Give a specific example of a protein with each type of tertiary structure.

Accepted Answer

Globular, fibrous, and membrane proteins are three different types of proteins with distinct overall shapes and functions.

Globular proteins are compact, rounded, and water-soluble. They often have a spherical shape and are involved in functions such as enzyme activity, transport, and signaling. An example of a globular protein is hemoglobin, which is responsible for transporting oxygen in the blood.

Fibrous proteins, on the other hand, have a long, extended shape and are often insoluble in water. They are involved in providing structural support and strength to cells and tissues. An example of a fibrous protein is collagen, which is found in connective tissues and provides strength and flexibility to the skin, tendons, and ligaments.

Membrane proteins are embedded within the lipid bilayer of cell membranes and have a variety of functions, including transport of molecules across the membrane, cell signaling, and cell adhesion. An example of a membrane protein is the sodium-potassium pump, which is responsible for maintaining the electrochemical gradient across the cell membrane.

In summary, globular proteins are compact and water-soluble, fibrous proteins are long and provide structural support, and membrane proteins are embedded in cell membranes and have diverse functions related to membrane transport and signaling. Each type of protein plays a crucial role in the overall function and structure of cells and tissues.

Question 3

You have isolated a novel protein, characterized its structure and determined that it catalyzes the breakdown of a large substrate and has two binding sites. One of these is large, apparently the binding site for the large substrate; the other is small, possibly a binding site for a regulatory molecule. What do these findings suggest to you about the mode of action of this protein?

Accepted Answer

A)  It is probably a structural protein that is found in tendons or bone. 
B)  It is probably an enzyme that is controlled through allosteric regulation. 
C)  It is probably an enzyme that works through autophosphorylation. 
D)  It is probably a transmembrane protein-like a G protein-coupled receptor. 
A)  It is probably a structural protein that is found in tendons or bone. 
B)  It is probably an enzyme that is controlled through allosteric regulation. 
C)  It is probably an enzyme that works through autophosphorylation. 
D)  It is probably a transmembrane protein-like a G protein-coupled receptor. B

Question 4

The C-terminus of a protein corresponds to

Accepted Answer

A)  the R-group of the first amino acid 
B)  the R-group of the last amino acid 
C)  the amino group of the first amino acid 
D)  the carboxyl group of the last amino acid 
A)  the R-group of the first amino acid 
B)  the R-group of the last amino acid 
C)  the amino group of the first amino acid 
D)  the carboxyl group of the last amino acid

Question 5

What is meant by primary, secondary, tertiary, and quaternary structures of proteins?

Accepted Answer

The primary, secondary, tertiary, and qu

Question 6

You have just sequenced a new protein found in Tetrahymena and observe that sulfur-containing cysteine residues occur at regular intervals in the sequence. Which hypothesis is supported by this observation?

Accepted Answer

A)  This protein contains many alpha helices. 
B)  This protein contains many beta-pleated sheets. 
C)  This protein's tertiary structure is stabilized by disulfide bridges. 
D)  This protein's tertiary structure is stabilized by hydrogen bonding. 
A)  This protein contains many alpha helices. 
B)  This protein contains many beta-pleated sheets. 
C)  This protein's tertiary structure is stabilized by disulfide bridges. 
D)  This protein's tertiary structure is stabilized by hydrogen bonding.

Question 7

The modified base 2-thiouracil found in tRNA can pair with

Accepted Answer

A)  the base A only 
B)  any of the three bases, U, C, and A 
C)  either A or G 
D)  any of the four bases, U, C, G, and A 
A)  the base A only 
B)  any of the three bases, U, C, and A 
C)  either A or G 
D)  any of the four bases, U, C, G, and A

Question 8

D- and L- amino acids

Accepted Answer

A)  contain different R groups 
B)  are used in equal proportion in most proteins 
C)  are enantiomers 
D)  contain different numbers of backbone carbon atoms 
A)  contain different R groups 
B)  are used in equal proportion in most proteins 
C)  are enantiomers 
D)  contain different numbers of backbone carbon atoms

Question 9

You are attempting to express a 50 kDa Tetrahymena protein from a cloned gene introduced into E. coli. When you purify the overexpressed protein you find that it is only 25 kDa in size. Discuss possible reasons for this result.

Accepted Answer

There are several possible reasons for t

Question 10

You treat cells with an inhibitor of the 26S proteasome. Predict the effect on cellular protein levels.

Accepted Answer

Cellular protein levels would

Question 11

Provide an explanation for why you should politely decline a serving of brains at a party hosted by cannibals.

Accepted Answer

You should politely decline a serving of

Question 12

You have determined the amino acid sequence of a new protein. Is it possible to determine the three-dimensional structure of the protein from its sequence? Why or why not?

Accepted Answer

It is possible to determine the three-di

Question 13

The "wobble hypothesis" states that

Accepted Answer

A)  alternative (non-Watson-Crick) base-pairing is permitted between a codon and anticodon at the third position. 
B)  a peptide backbone can bend between the central carbon and the amino group's N or the carboxyl group's C. 
C)  an allosteric regulator can induce a protein to "wobble" between two conformations. 
D)  amino acids can spontaneously isomerize between the D- and L- forms. 
A)  alternative (non-Watson-Crick) base-pairing is permitted between a codon and anticodon at the third position. 
B)  a peptide backbone can bend between the central carbon and the amino group's N or the carboxyl group's C. 
C)  an allosteric regulator can induce a protein to "wobble" between two conformations. 
D)  amino acids can spontaneously isomerize between the D- and L- forms.

Question 14

Describe a specific example of control of enzyme activity by post-translational modification and allosteric regulation.

Accepted Answer

One specific example of control of enzym

Question 15

Replacing an A with a T in a hemoglobin gene is associated with sickle-cell anemia in humans.
Normal: 5′-ATGGTGCACCTGACTCCTGAGGAGAAGTCT-3′
Sickle cell: 5′-ATGGTGCACCTGACTCCTGTGGAGAAGTCT-3′
(a) What is the nucleotide sequence of the normal and sickle-cell hemoglobin mRNA?
(b) What is the amino acid sequence in this part of the polypeptide chain, and what is the amino acid replacement that results in sickle-cell hemoglobin?
(c) Why might this amino acid substitution make a difference in protein structure?

Accepted Answer

(a) Normal: AUGGUGCACCUGACUCCUGAGGAGAAGU

Question 16

Which of the following illustrates quaternary protein structure?

Accepted Answer

A)  an allosteric ligand 
B)  an actin monomer 
C)  hemoglobin 
D)  a metal-binding protein 
A)  an allosteric ligand 
B)  an actin monomer 
C)  hemoglobin 
D)  a metal-binding protein

Question 17

The frequencies with which different codons are used vary significantly between different organisms and between proteins expressed at high or low levels within the same organism. This is referred to as:

Accepted Answer

A)  stratification 
B)  codon variegation 
C)  heterologous codons 
D)  codon bias 
A)  stratification 
B)  codon variegation 
C)  heterologous codons 
D)  codon bias

Question 18

Short unstructured regions of a protein that connect secondary structural elements are called

Accepted Answer

A)  beta hooks 
B)  turns 
C)  barrels 
D)  branch points 
A)  beta hooks 
B)  turns 
C)  barrels 
D)  branch points

Question 19

Use a rough diagram to compare the structures of a protein alpha-helix and a beta-pleated sheet. For simplicity, show only the backbone of the polypeptide chain.

Accepted Answer

The alpha-helix and beta-pleated sheet a

Question 20

An alpha helix is stabilized by

Accepted Answer

A)  van der Waals interactions between R-group atoms in the helix interior 
B)  ionic bonding between R-group atoms of residues located near one another 
C)  hydrogen bonding between backbone atoms of residues located near one another 
D)  peptide bonding between backbone atoms of non-adjacent residues 
A)  van der Waals interactions between R-group atoms in the helix interior 
B)  ionic bonding between R-group atoms of residues located near one another 
C)  hydrogen bonding between backbone atoms of residues located near one another 
D)  peptide bonding between backbone atoms of non-adjacent residues

Which of the following is NOT true about protein structure?

Compare and contrast the overall shape and function of globular, fibrous, and membrane proteins. Give a specific example of a protein with each type of tertiary structure.

The C-terminus of a protein corresponds to

What is meant by primary, secondary, tertiary, and quaternary structures of proteins?

You have just sequenced a new protein found in Tetrahymena and observe that sulfur-containing cysteine residues occur at regular intervals in the sequence. Which hypothesis is supported by this observation?

The modified base 2-thiouracil found in tRNA can pair with

D- and L- amino acids

You are attempting to express a 50 kDa Tetrahymena protein from a cloned gene introduced into E. coli. When you purify the overexpressed protein you find that it is only 25 kDa in size. Discuss possible reasons for this result.

You treat cells with an inhibitor of the 26S proteasome. Predict the effect on cellular protein levels.

Provide an explanation for why you should politely decline a serving of brains at a party hosted by cannibals.

You have determined the amino acid sequence of a new protein. Is it possible to determine the three-dimensional structure of the protein from its sequence? Why or why not?

The "wobble hypothesis" states that

Describe a specific example of control of enzyme activity by post-translational modification and allosteric regulation.

Which of the following illustrates quaternary protein structure?

The frequencies with which different codons are used vary significantly between different organisms and between proteins expressed at high or low levels within the same organism. This is referred to as:

Short unstructured regions of a protein that connect secondary structural elements are called

Use a rough diagram to compare the structures of a protein alpha-helix and a beta-pleated sheet. For simplicity, show only the backbone of the polypeptide chain.

An alpha helix is stabilized by

The Beginnings of Molecular Biology

The Structure of DNA

The Versatility of RNA

Genome Organization and Evolution

DNA Replication and Telomere Maintenance

DNA Repair Pathways

Recombinant Dna Technology and Molecular Cloning

Tools for Analyzing Gene Expression

Transcription in Bacteria

Transcription in Eukaryotes

Epigenetic Mechanisms of Gene Regulation

RNA Processing and Post-Transcriptional Gene Regulation

The Mechanism of Translation

Genetically Modified Organisms: Use in Basic and Applied Research

Genome Analysis: DNA Typing, Genomics, and Beyond

Medical Molecular Biology

Filters

Exam 4: Protein Structure and Folding

Which of the following is NOT true about protein structure?

Compare and contrast the overall shape and function of globular, fibrous, and membrane proteins. Give a specific example of a protein with each type of tertiary structure.

The C-terminus of a protein corresponds to

What is meant by primary, secondary, tertiary, and quaternary structures of proteins?

You have just sequenced a new protein found in Tetrahymena and observe that sulfur-containing cysteine residues occur at regular intervals in the sequence. Which hypothesis is supported by this observation?

The modified base 2-thiouracil found in tRNA can pair with

D- and L- amino acids

You are attempting to express a 50 kDa Tetrahymena protein from a cloned gene introduced into E. coli. When you purify the overexpressed protein you find that it is only 25 kDa in size. Discuss possible reasons for this result.

You treat cells with an inhibitor of the 26S proteasome. Predict the effect on cellular protein levels.

Provide an explanation for why you should politely decline a serving of brains at a party hosted by cannibals.

You have determined the amino acid sequence of a new protein. Is it possible to determine the three-dimensional structure of the protein from its sequence? Why or why not?

The "wobble hypothesis" states that

Describe a specific example of control of enzyme activity by post-translational modification and allosteric regulation.

Which of the following illustrates quaternary protein structure?

The frequencies with which different codons are used vary significantly between different organisms and between proteins expressed at high or low levels within the same organism. This is referred to as:

Short unstructured regions of a protein that connect secondary structural elements are called

Use a rough diagram to compare the structures of a protein alpha-helix and a beta-pleated sheet. For simplicity, show only the backbone of the polypeptide chain.

An alpha helix is stabilized by

The Beginnings of Molecular Biology

The Structure of DNA

The Versatility of RNA

Genome Organization and Evolution

DNA Replication and Telomere Maintenance

DNA Repair Pathways

Recombinant Dna Technology and Molecular Cloning

Tools for Analyzing Gene Expression

Transcription in Bacteria

Transcription in Eukaryotes

Epigenetic Mechanisms of Gene Regulation

RNA Processing and Post-Transcriptional Gene Regulation

The Mechanism of Translation

Genetically Modified Organisms: Use in Basic and Applied Research

Genome Analysis: DNA Typing, Genomics, and Beyond

Medical Molecular Biology

Filters