Question 1

What is the significance of CODIS?

Accepted Answer

A)  CODIS aids in setting free wrongfully accused people. 
B)  CODIS contains more than 4.5 million profiles from criminals in 50 states. 
C)  Each DNA profile in CODIS contains 15 specific STRs. 
D)  CODIS can help identify suspects when other methods cannot. 
E)  All of the above. 
A)  CODIS aids in setting free wrongfully accused people. 
B)  CODIS contains more than 4.5 million profiles from criminals in 50 states. 
C)  Each DNA profile in CODIS contains 15 specific STRs. 
D)  CODIS can help identify suspects when other methods cannot. 
E)  All of the above.

Question 2

Where are chromosomes located in eukaryotic cells?

Accepted Answer

A)  cytoplasm 
B)  nucleus 
C)  specialized protein sacs 
D)  tightly wrapped together 
E)  centromeres 
A)  cytoplasm 
B)  nucleus 
C)  specialized protein sacs 
D)  tightly wrapped together 
E)  centromeres

Question 3

Here are non-coding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12: 
Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC
Bob: TTCGTTCCCAGCTAGCTTAACCGGC
Which of the following accurately compares Mary and Bob's DNA?

Accepted Answer

A)  Mary and Bob are most likely fraternal twins. 
B)  Mary has five STRs at this site; Bob has two. 
C)  Mary has one STR at this site; Bob has none. 
D)  The DNA shown must be from the 23rd chromosome, not the 12th. 
E)  None of the above 
A)  Mary and Bob are most likely fraternal twins. 
B)  Mary has five STRs at this site; Bob has two. 
C)  Mary has one STR at this site; Bob has none. 
D)  The DNA shown must be from the 23rd chromosome, not the 12th. 
E)  None of the above

Question 4

You collect cells from a patient's kidney and liver and isolate DNA from each sample separately.You use that DNA to obtain a genetic fingerprint for liver versus kidney.What do you expect to see?

Accepted Answer

A)  STR profiles will be completely different because liver and kidney have completely different functions, and thus completely different genes. 
B)  STR profiles will be related, but not identical, because different cell types have different numbers of STR's. 
C)  STR profiles will be identical because all cells belonging to an individual have the same DNA and the same genes. 
D)  STR profiles may be identical or completely different because half of a person's DNA comes from Mom and the other half comes from Dad. 
E)  Any of the above may be true. 
A)  STR profiles will be completely different because liver and kidney have completely different functions, and thus completely different genes. 
B)  STR profiles will be related, but not identical, because different cell types have different numbers of STR's. 
C)  STR profiles will be identical because all cells belonging to an individual have the same DNA and the same genes. 
D)  STR profiles may be identical or completely different because half of a person's DNA comes from Mom and the other half comes from Dad. 
E)  Any of the above may be true.

Question 5

DNA is a type of molecule called a _________.Its smaller parts are called __________.

Accepted Answer

A)  protein; amino acids 
B)  deoxyribonucleic acid; amino acids 
C)  deoxyribonucleic acid; nucleotides 
D)  nucleotide; deoxyribonucleic acids 
E)  protein; nucleotides 
A)  protein; amino acids 
B)  deoxyribonucleic acid; amino acids 
C)  deoxyribonucleic acid; nucleotides 
D)  nucleotide; deoxyribonucleic acids 
E)  protein; nucleotides

Question 6

What is "junk DNA"? What important use do scientists have for "junk DNA"?

Accepted Answer

"Junk DNA" refers to non-coding DNA.This

Question 7

DNA can be found in/on

Accepted Answer

A)  a fresh blood sample. 
B)  a hair follicle. 
C)  a sperm cell. 
D)  your pencil. 
E)  All of the above 
A)  a fresh blood sample. 
B)  a hair follicle. 
C)  a sperm cell. 
D)  your pencil. 
E)  All of the above

Question 8

How does PCR aid in detecting genetic differences from a small starting sample,say a strand of hair?

Accepted Answer

PCR increases the number of copies of DN

Question 9

STR DNA analysis can be used for all of the following applications EXCEPT

Accepted Answer

A)  determining time of death. 
B)  identifying a missing person. 
C)  paternity testing. 
D)  crime scene suspect identification. 
E)  ruling out a potential suspect. 
A)  determining time of death. 
B)  identifying a missing person. 
C)  paternity testing. 
D)  crime scene suspect identification. 
E)  ruling out a potential suspect.

Question 10

If a strand of DNA has the sequence ATTCGGC,the complementary strand would be .

Accepted Answer

The answer of If a strand of DNA has the...

Question 11

Where is DNA found?

Accepted Answer

A)  chromosomes 
B)  blood 
C)  saliva 
D)  hair root 
E)  All of the above. 
A)  chromosomes 
B)  blood 
C)  saliva 
D)  hair root 
E)  All of the above.

Question 12

CODIS is a database that has

Accepted Answer

A)  helped to convict over 1 million criminals. 
B)  been used to free 45,000 persons who were wrongfully arrested. 
C)  only rarely been useful for identifying potential suspects. 
D)  records for over 4.5 million criminal DNA profiles. 
E)  helped to convict over 4.5 million criminals. 
A)  helped to convict over 1 million criminals. 
B)  been used to free 45,000 persons who were wrongfully arrested. 
C)  only rarely been useful for identifying potential suspects. 
D)  records for over 4.5 million criminal DNA profiles. 
E)  helped to convict over 4.5 million criminals.

Question 13

You are a juror at a trial and you have been told that the suspect's DNA was found at the crime scene.The DNA came from a sweat-stained shirt and saliva on a cigarette butt.Several other jurors are quite skeptical of this information,adamant in their belief that sweat and saliva are body fluids and therefore should not contain DNA.How do you explain the scientific basis of this evidence to them during deliberations in the jury chamber?

Accepted Answer

The other jurors are correct that sweat

Question 14

You are running gel electrophoresis on several samples of DNA collected from a crime scene.When you look at the gel,you notice that suspect number 2 has three bands for one STR.Is this a problem? Why or why not?

Accepted Answer

Yes,this is a problem.Every person inher

Question 15

You have a segment of DNA with a nucleotide sequence reading AATAGC on one strand.Which of the following nucleotide sequences would match it on the opposite strand?

Accepted Answer

A)  AATAGC 
B)  CCGCTA 
C)  GGCGAT 
D)  TTATCG 
E)  AAGACG 
A)  AATAGC 
B)  CCGCTA 
C)  GGCGAT 
D)  TTATCG 
E)  AAGACG

Question 16

When DNA is copied to make more DNA before cell division,what happens to the original DNA molecule?

Accepted Answer

A)  The original DNA goes to one cell; the new DNA goes to the other cell. 
B)  Only new DNA is passed on; original DNA is broken down and recycled. 
C)  Each of the cells contains half of the original DNA and half new DNA. 
D)  The original DNA is twisted into a double helix and passed to one of the daughter cells. 
E)  Either A or C are true, depending on the organism. 
A)  The original DNA goes to one cell; the new DNA goes to the other cell. 
B)  Only new DNA is passed on; original DNA is broken down and recycled. 
C)  Each of the cells contains half of the original DNA and half new DNA. 
D)  The original DNA is twisted into a double helix and passed to one of the daughter cells. 
E)  Either A or C are true, depending on the organism.

Question 17

A nucleotide is composed of a sugar,a ____ and a ______.

Accepted Answer

The answer of A nucleotide is composed of a sugar,a...

Question 18

What is the "double helix" when referring to the structure of DNA?

Accepted Answer

A)  two strands of linked nucleotides that are twisted around each other 
B)  two strands of linked nucleotides that fold back and forth like an accordion 
C)  four strands of linked nucleotides that are bound by phosphate groups 
D)  four strands of linked nucleotides that are bound by sugar groups 
E)  two chromosomes that twisted around each other 
A)  two strands of linked nucleotides that are twisted around each other 
B)  two strands of linked nucleotides that fold back and forth like an accordion 
C)  four strands of linked nucleotides that are bound by phosphate groups 
D)  four strands of linked nucleotides that are bound by sugar groups 
E)  two chromosomes that twisted around each other

Question 19

Some highly degraded DNA was collected from a crime scene.Upon analysis,forensic scientists were only able to accurately sequence one 450-nucleotide-long segment of DNA from a Y chromosome.There are five suspects in the case,but they have fled the state.However,they all have large extended families in the area.How can the police narrow the search to just one suspect?

Accepted Answer

A)  Collect DNA from male siblings, fathers, or paternal grandfathers. 
B)  Collect DNA from sisters, mothers, and maternal grandmothers. 
C)  Collect DNA from any male relatives on the mother's or father's side. 
D)  Collect DNA from any female relatives on the mother's or father's side. 
E)  Collect DNA from any available blood relatives of any gender. 
A)  Collect DNA from male siblings, fathers, or paternal grandfathers. 
B)  Collect DNA from sisters, mothers, and maternal grandmothers. 
C)  Collect DNA from any male relatives on the mother's or father's side. 
D)  Collect DNA from any female relatives on the mother's or father's side. 
E)  Collect DNA from any available blood relatives of any gender.

Question 20

DNA analysis is used in

Accepted Answer

A)  paternity suits. 
B)  placing suspects at the scene of a crime. 
C)  analysis of mummies. 
D)  identifying corpses. 
E)  All of the above. 
A)  paternity suits. 
B)  placing suspects at the scene of a crime. 
C)  analysis of mummies. 
D)  identifying corpses. 
E)  All of the above.

Exam 7: DNA Structure and Replication Biologically Unique

What is the significance of CODIS?

Where are chromosomes located in eukaryotic cells?

Here are non-coding sequences from Mary and Bob.Both sequences come from the same region of chromosome 12: Mary: TTCGTTCCCAGCTAGCTAGCTAGCTAGCTTAACCGGC Bob: TTCGTTCCCAGCTAGCTTAACCGGC Which of the following accurately compares Mary and Bob's DNA?

You collect cells from a patient's kidney and liver and isolate DNA from each sample separately.You use that DNA to obtain a genetic fingerprint for liver versus kidney.What do you expect to see?

DNA is a type of molecule called a _________.Its smaller parts are called __________.

What is "junk DNA"? What important use do scientists have for "junk DNA"?

DNA can be found in/on

How does PCR aid in detecting genetic differences from a small starting sample,say a strand of hair?

STR DNA analysis can be used for all of the following applications EXCEPT

If a strand of DNA has the sequence ATTCGGC,the complementary strand would be .

Where is DNA found?

CODIS is a database that has

You are running gel electrophoresis on several samples of DNA collected from a crime scene.When you look at the gel,you notice that suspect number 2 has three bands for one STR.Is this a problem? Why or why not?

You have a segment of DNA with a nucleotide sequence reading AATAGC on one strand.Which of the following nucleotide sequences would match it on the opposite strand?

When DNA is copied to make more DNA before cell division,what happens to the original DNA molecule?

A nucleotide is composed of a sugar,a ____ and a ______.

What is the "double helix" when referring to the structure of DNA?

DNA analysis is used in

The Process of Science Java Report

Chemistry and Molecules of Life Mission to Mars

Cell Function and Structure Wonder Drug

Nutrition,metabolism,enzymes the Peanut Butter Project

Energy Flow and Photosynthesis the Future of Fuel

Dietary Energy and Cellular Respiration Supersize Me

Genes to Proteins Medicine From Milk

Cell Division and Mitosis Natures Pharmacy

Mutations and Cancer Fighting Fate

Single-Gene Inheritance and Meiosis Rock for a Cause

Complex Inheritance Qa: Genetics

Stem Cells and Cell Differentiation Grow Your Own

Natural Selection and Adaptation Bugs That Resist Drugs

A: Nonadaptive Evolution and Speciation Urban Evolution

B: Nonadaptive Evolution and Speciation Urban Evolution

Evidence for Evolution a Fish With Fingers

Life on Earth Qa: Evolution

Prokaryotic Diversity Lost City

A: Eukaryotic Diversity Rain Forest Riches

B: Eukaryotic Diversity Rain Forest Riches

Human Evolution Skin Deep

A: Population Ecology on the Tracks of Wolves and Moose

B: Population Ecology on the Tracks of Wolves and Moose

A: Community Ecology Whats Happening to Honey Bees

B: Community Ecology Whats Happening to Honey Bees

A: Ecosystem Ecology the Heat Is on

B: Ecosystem Ecology the Heat Is on

A: Sustainability the Makings of a Green City

B: Sustainability the Makings of a Green City

A: Overview of Physiology Man Versus Mountain

B: Overview of Physiology Man Versus Mountain

Digestive System Drastic Measures

A: Cardiovascular System Death in Bogalusa

B: Cardiovascular System Death in Bogalusa

Respiratory System Peak Performance

A: Central Nervous System Smoke on the Brain

B: Central Nervous System Smoke on the Brain

Reproductive System Too Many Multiples

Immune System Viral Mysteries

A: Plant Physiology

B: Plant Physiology

Filters

DNA is a type of molecule called a _.Its smaller parts are called __.

A nucleotide is composed of a sugar,a and a __.