Exam 15: The Genetic Code and Translation

Four different uracil auxotrophs of Neurospora, a eukaryotic mold, are tested for growth on uracil and uracil precursors. The data are shown in the following table. A plus sign (+) means growth. $\quad\quad\quad\quad\quad\quad\quad { \text { Compound } }$ A B C D Uracil Mutant 1 + + + - + Mutant 2 - - + - + Mutant 3 + - + - + Mutant 4 - - - - + - Diagram the uracil pathway, showing the step at which each mutant is blocked.

During elongation, an incoming charged tRNA enters at the _____ site of the ribosome.

Use the following to answer questions -If the bottom strand of the DNA is the template, the tRNA anticodon sequence for the first RNA codon, left to right or 5' to 3', is:

Which of the following statements about translation is CORRECT?

What would be the effect on the following amino acid sequence if the sequence were changed to 5'GGAGACUCGUUGUAUU 3'? Explain why the amino acid sequence changes. 5' ...GGAGCUCGUUGUAUU... 3'

Four different uracil auxotrophs of Neurospora, a eukaryotic mold, are tested for growth on uracil and uracil precursors. The data are shown in the following table. A plus sign (+) means growth. $\quad\quad\quad\quad\quad\quad\quad { \text { Compound } }$ A B C D Uracil Mutant 1 + + + - + Mutant 2 - - + - + Mutant 3 + - + - + Mutant 4 - - - - + -Neurospora can be grown as haploids or diploids. Haploid mutants 1 and 2 are fused to make a diploid. If both 1 and 2 carry recessive mutations, on which compounds will the diploid be able to grow?

Use the following to answer questions An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. ade wild-type allele mutant allele 5'...TTATGGGCAAGATCCCA...3' 5'....TTA TGGGCTAGATCCCA...3' 3'...AATACCCGTTCTAGGGT...5' 3'...AATATGGGCTAGATCCCA...3' -E. coli strains that have both the original ade1^- mutant allele shown above and a mutant allele for a gene that encodes a lysine tRNA are able to make some normal ade1 enzyme. The mutant lysine tRNA allele makes a tRNA that has one base that is different from the wild-type tRNA. Which of the following statements would help explain how the lysine tRNA mutation allows synthesis of the normal ade1 enzyme? (Select all that apply.)

An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it?

Use the following to answer questions An auxotrophic E. coli strain requires adenine to grow because of a mutation in a gene for an adenine synthesis enzyme. The following shows part of the wild-type and mutant alleles of the gene, including the start codon. The bottom strand is the template for transcription. ade wild-type allele mutant allele 5'...TTATGGGCAAGATCCCA...3' 5'....TTA TGGGCTAGATCCCA...3' 3'...AATACCCGTTCTAGGGT...5' 3'...AATATGGGCTAGATCCCA...3' -How does the mutation affect the enzyme?

Which of the following is NOT required during the process of tRNA charging?

The amino acid sequence of a polypeptide is referred to as the _____ sequence of the polypeptide.

Which of the following statements about the formation of the peptide bond between amino acids is INCORRECT?

Although the genetic code is nearly universal, some variations do exist. In vertebrate mitochondria, UGA codes for Trp (instead of termination), AUA codes for Met (instead of Ile), and AGA and AGG are stop codons (instead of coding for Arg). Translate the following coding strand DNA sequences using both the standard code and the vertebrate mitochondrial code. a. 5' ATGGCCATAAGATGA 3' b. 5' ATGGGGGATCGCTAA 3' c. 5' ATGTGATGGCATCTTATAAATTGATAA 3'

Which of the following is observed in prokaryotes but not in eukaryotes?

Which amino acid is coded by the stop codons in most organisms?

During initiation of translation: