Question 1

Which mechanism allows for more than one polypeptide to be encoded by a single gene?

Accepted Answer

A)  regulated transcription 
B)  RNA interference 
C)  alternative RNA processing 
D)  self-splicing of introns 
E)  RNA methylation 
A)  regulated transcription 
B)  RNA interference 
C)  alternative RNA processing 
D)  self-splicing of introns 
E)  RNA methylation

Question 2

Below is a list of steps of intron removal and splicing during pre-mRNA processing. Please select the choice that lists the steps in the CORRECT sequential order. 1. Attachment of snRNP U1 to the 5'splice site
2) Transcription of the DNA template into the pre-mRNA molecule
3) Release of lariat structure
4) Splicing together of exons
5) Transesterification reaction at the branch point adenine

Accepted Answer

A)  1, 2, 3, 4, 5 
B)  4, 1, 3, 5, 2 
C)  2, 1, 5, 3, 4 
D)  3, 5, 1, 2, 4 
E)  5, 3, 4, 1, 2 
A)  1, 2, 3, 4, 5 
B)  4, 1, 3, 5, 2 
C)  2, 1, 5, 3, 4 
D)  3, 5, 1, 2, 4 
E)  5, 3, 4, 1, 2

Question 3

What do group I and group II introns have in common?

Accepted Answer

A)  Both are found in mitochondrial genes. 
B)  Both are found in bacteriophages. 
C)  Both are known to be self-splicing introns. 
D)  Both are found in protein-coding genes of chloroplasts. 
E)  Both are frequently found in eukaryotic genes. 
A)  Both are found in mitochondrial genes. 
B)  Both are found in bacteriophages. 
C)  Both are known to be self-splicing introns. 
D)  Both are found in protein-coding genes of chloroplasts. 
E)  Both are frequently found in eukaryotic genes.

Question 4

Which of the following consensus sequences are NOT found in nuclear introns?

Accepted Answer

A)  GU at the 5' splice site at the beginning of the intron 
B)  AG at the 3' splice site at the end of the intron 
C)  CCA at the 3' site downstream of the branch point 
D)  a at the lariat branch point site 
E)  3' CAGG consensus sequence at the 3'splice site 
A)  GU at the 5' splice site at the beginning of the intron 
B)  AG at the 3' splice site at the end of the intron 
C)  CCA at the 3' site downstream of the branch point 
D)  a at the lariat branch point site 
E)  3' CAGG consensus sequence at the 3'splice site

Question 5

What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron?

Accepted Answer

A)  A shorter than normal protein would be produced. 
B)  Replication would be inhibited. 
C)  A longer than normal mRNA would be produced. 
D)  A longer than normal DNA would be produced. 
E)  Transcription would terminate prematurely. 
A)  A shorter than normal protein would be produced. 
B)  Replication would be inhibited. 
C)  A longer than normal mRNA would be produced. 
D)  A longer than normal DNA would be produced. 
E)  Transcription would terminate prematurely.

Question 6

What is an snRNP and what role does it play in the cell?

Accepted Answer

An snRNP, or small nuclear ribonucleopro

Question 7

A key modification in the 3' end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

Accepted Answer

A)  The stability of mRNA transcripts in the cytoplasm is affected by the poly(
A)  tail. 
B)  The poly(
A)  tail facilitates the attachment of the ribosome to the mRNA. 
C)  The poly(
A)  tail is important for proper nuclear export of the mRNA. 
D)  The poly(
A)  tail at the 3' end translates to a long stretch of repeated amino acids. 
E)  Multiple proteins will recognize and bind to the poly(
A)  tail in the cytoplasm. 
A)  The stability of mRNA transcripts in the cytoplasm is affected by the poly(
A)  tail. 
B)  The poly(
A)  tail facilitates the attachment of the ribosome to the mRNA. 
C)  The poly(
A)  tail is important for proper nuclear export of the mRNA. 
D)  The poly(
A)  tail at the 3' end translates to a long stretch of repeated amino acids. 
E)  Multiple proteins will recognize and bind to the poly(
A)  tail in the cytoplasm.

Question 8

What attributes make miRNA a potent agent for silencing gene expression by allowing it to silence a large number of genes simultaneously?

Accepted Answer

MicroRNAs (miRNAs) are small non-coding

Question 9

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

Accepted Answer

A)  The U2 snRNA would not be able to bind to the branch point because it could not recognize it. 
B)  The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site. 
C)  The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site. 
D)  Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site. 
E)  The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional. 
A)  The U2 snRNA would not be able to bind to the branch point because it could not recognize it. 
B)  The spliceosome complex would be degraded because it could no longer recognize the 5ʹ splice site. 
C)  The U1 snRNA would not be able to bind complementarily to the 5ʹ splice site. 
D)  Splicing would still occur appropriately because the G is not essential at the 5ʹ splice site. 
E)  The 5ʹ cap would not be able to be added because it requires the 5ʹ splice site to be functional.

Question 10

What are guide RNAs (gRNAs) and what do they do?

Accepted Answer

Guide RNAs (gRNAs) are short synthetic R

Question 11

Which of the following statements CORRECTLY describes the facts about introns and exons?

Accepted Answer

A)  The number of introns is always less than the number of exons in a gene. 
B)  Introns are degraded in the cytoplasm. 
C)  All eukaryotic genes contain an intron. 
D)  Mitochondrial and chloroplast genes do not contain introns. 
E)  Introns do not contain sequence-specific information. 
A)  The number of introns is always less than the number of exons in a gene. 
B)  Introns are degraded in the cytoplasm. 
C)  All eukaryotic genes contain an intron. 
D)  Mitochondrial and chloroplast genes do not contain introns. 
E)  Introns do not contain sequence-specific information.

Question 12

Compare and contrast the mechanisms of splicing for nuclear pre-mRNA introns, group I introns, group II introns, and tRNA introns.

Accepted Answer

Splicing is the process by which non-cod

Question 13

Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ cap. What would be an expected result?

Accepted Answer

A)  Transcription would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. 
B)  Translation would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. 
C)  Transcription would not occur as the transcription factors would not be able to bind to the promoter. 
D)  Translation would not occur as the ribosome would not be able to bind to the mRNA. 
E)  Replication would not occur as DNA polymerase would not be able to bind to the DNA at the origin of replication. 
A)  Transcription would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. 
B)  Translation would continue past the end of the gene coding sequence resulting in a longer pre-mRNA transcript. 
C)  Transcription would not occur as the transcription factors would not be able to bind to the promoter. 
D)  Translation would not occur as the ribosome would not be able to bind to the mRNA. 
E)  Replication would not occur as DNA polymerase would not be able to bind to the DNA at the origin of replication.

Question 14

During the posttranscriptional processing of pre-mRNA, a 5' cap is added to an mRNA. Arrange the following steps of the capping process in the CORRECT order. 1. Addition of a guanine nucleotide via a 5'-5' bond
2) Removal of a phosphate from a ribonucleotide triphosphate at the 5' head of the pre-mRNA
3) Methylation at the 2' position of the sugar in the second and the third nucleotides
4) Methylation at position 7 of the terminal guanine base

Accepted Answer

A)  1, 2, 3, 4 
B)  2, 4, 1, 3 
C)  4, 1, 3, 2 
D)  2, 1, 4, 3 
E)  3, 2, 4, 1 
A)  1, 2, 3, 4 
B)  2, 4, 1, 3 
C)  4, 1, 3, 2 
D)  2, 1, 4, 3 
E)  3, 2, 4, 1

Question 15

Which of the following spliceosomal components specifically recognizes and binds to the branch point of the intron during pre-mRNA splicing?

Accepted Answer

A)  U1 
B)  U2 
C)  U5 
D)  U6 
E)  spliceosomal proteins 
A)  U1 
B)  U2 
C)  U5 
D)  U6 
E)  spliceosomal proteins

Question 16

Which class of RNA is MOST abundant in cells?

Accepted Answer

A)  mRNA 
B)  tRNA 
C)  rRNA 
D)  snRNA 
E)  miRNA 
A)  mRNA 
B)  tRNA 
C)  rRNA 
D)  snRNA 
E)  miRNA

Question 17

Which of the following rRNA components originates from a separate gene transcript rather than as a cleaved product of a long single precursor rRNA transcript?

Accepted Answer

A)  prokaryotic 16S rRNA 
B)  prokaryotic 23S rRNA 
C)  eukaryotic 18S rRNA 
D)  eukaryotic 5.8S rRNA 
E)  eukaryotic 5S rRNA 
A)  prokaryotic 16S rRNA 
B)  prokaryotic 23S rRNA 
C)  eukaryotic 18S rRNA 
D)  eukaryotic 5.8S rRNA 
E)  eukaryotic 5S rRNA

Question 18

Which of the following classes of RNAs is unique to eukaryotes?

Accepted Answer

A)  messenger RNA (mRN
A)  
B)  ribosomal RNA (rRN
A)  
C)  transfer RNA (tRN
A)  
D)  small nuclear RNAs (snRNAs) 
E)  CRISPR RNAs (crRNAs) 
A)  messenger RNA (mRN
A)  
B)  ribosomal RNA (rRN
A)  
C)  transfer RNA (tRN
A)  
D)  small nuclear RNAs (snRNAs) 
E)  CRISPR RNAs (crRNAs)

Question 19

Which mechanism allows for the production of polypeptides that are not entirely encoded by DNA?

Accepted Answer

A)  regulated transcription 
B)  RNA interference 
C)  alternative RNA processing 
D)  RNA editing 
E)  colinearity 
A)  regulated transcription 
B)  RNA interference 
C)  alternative RNA processing 
D)  RNA editing 
E)  colinearity

Question 20

Discuss the features of C. elegans that make it an important model system for studies of animal genetics and development. Include in your answer some unique features of C. elegans compared to other model systems.

Accepted Answer

C. elegans, also known as Caenorhabditis

Exam 14: Rna Molecules and Rna Processing

Which mechanism allows for more than one polypeptide to be encoded by a single gene?

What do group I and group II introns have in common?

Which of the following consensus sequences are NOT found in nuclear introns?

What would be the MOST likely effect of mutating the consensus sequence found at the 5' splice site of an intron?

What is an snRNP and what role does it play in the cell?

A key modification in the 3' end of eukaryotic mRNA is the addition of 50 to 250 adenine nucleotides, forming a poly(A) tail. Which of the following is NOT a function of the poly(A) tail?

What attributes make miRNA a potent agent for silencing gene expression by allowing it to silence a large number of genes simultaneously?

The sequence below represents a pre-mRNA. What would happen if the G in the 5ʹ splice site were mutated to a C? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

What are guide RNAs (gRNAs) and what do they do?

Which of the following statements CORRECTLY describes the facts about introns and exons?

Compare and contrast the mechanisms of splicing for nuclear pre-mRNA introns, group I introns, group II introns, and tRNA introns.

Suppose a mutation occurred that prevented a eukaryotic pre-mRNA from receiving a 5ʹ cap. What would be an expected result?

Which of the following spliceosomal components specifically recognizes and binds to the branch point of the intron during pre-mRNA splicing?

Which class of RNA is MOST abundant in cells?

Which of the following rRNA components originates from a separate gene transcript rather than as a cleaved product of a long single precursor rRNA transcript?

Which of the following classes of RNAs is unique to eukaryotes?

Which mechanism allows for the production of polypeptides that are not entirely encoded by DNA?

Discuss the features of C. elegans that make it an important model system for studies of animal genetics and development. Include in your answer some unique features of C. elegans compared to other model systems.

Introduction to Genetics

Chromosomes and Cellular Reproduction

Basic Principles of Heredity

Sex Determination and Sex-Linked Characteristics

Extensions and Modifications of Basic Principles

Pedigree Analysis, Applications, and Genetic Testing

Linkage, Recombination, and Eukaryotic Gene Mapping

Chromosome Variation

Bacterial and Viral Genetic Systems

DNA: the Chemical Nature of the Gene

Chromosome Structure and Organelle Dna

DNA Replication and Recombination

Transcription

The Genetic Code and Translation

Control of Gene Expression in Prokaryotes

Control of Gene Expression in Eukaryotes

Gene Mutations and Dna Repair

Molecular Genetic Analysis and Biotechnology

Genomics and Proteomics

Epigenetics

Developmental Genetics and Immunogenetics

Cancer Genetics

Quantitative Genetics

Population Genetics

Evolutionary Genetics

Filters