Question 1

The spliceosome is a large, ribonucleoprotein complex located in the:

Accepted Answer

A)  cytoplasm. 
B)  endoplasmic reticulum. 
C)  Golgi aparatus. 
D)  nucleus. 
E)  nucleolus. 
A)  cytoplasm. 
B)  endoplasmic reticulum. 
C)  Golgi aparatus. 
D)  nucleus. 
E)  nucleolus.

Question 2

In your own words, list a comprehensive definition for "gene" at the molecular level.

Accepted Answer

A gene at the molecular level can be def

Question 3

During the posttranscriptional processing of pre-mRNA, a 5' cap is added to an mRNA in step-by-step manner. Which of the following reasons prevents the 5'capping process, involving methylation, from occurring on a DNA strand?

Accepted Answer

A)  lack of an OH group on the 2' carbon of the deoxyribose 
B)  lack of an OH group on the 3' carbon of the deoxyribose 
C)  lack of a uracil nitrogenous base on the DNA strand 
D)  lack of GTP hydrolysis associated with DNA transcription 
E)  lack of a H on the 4' carbon of the deoxyribose 
A)  lack of an OH group on the 2' carbon of the deoxyribose 
B)  lack of an OH group on the 3' carbon of the deoxyribose 
C)  lack of a uracil nitrogenous base on the DNA strand 
D)  lack of GTP hydrolysis associated with DNA transcription 
E)  lack of a H on the 4' carbon of the deoxyribose

Question 4

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation?

Accepted Answer

A)  The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly. 
B)  The 5ʹ cap could recruit proteins that would help to assemble the ribosomes. 
C)  The 5ʹ cap could assist in the identification of stop codons within the mRNA. 
D)  The 5ʹ cap could serve as a marker for the ribosome to locate promoters. 
E)  The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to the DNA. 
A)  The 5ʹ cap could assist in bringing together the snRNPs for spliceosome assembly. 
B)  The 5ʹ cap could recruit proteins that would help to assemble the ribosomes. 
C)  The 5ʹ cap could assist in the identification of stop codons within the mRNA. 
D)  The 5ʹ cap could serve as a marker for the ribosome to locate promoters. 
E)  The 5ʹ cap could assist in the unwinding of the DNA to allow ribosome access to the DNA.

Question 5

Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene comprises approximately 190,000 nucleotides and produces an mRNA of 6128 nucleotides in length. What is a possible explanation for the difference in the sizes of the gene and the mRNA?

Accepted Answer

A)  The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA production. 
B)  The CFTR gene likely has many introns that are excised prior to translation of the CFTR protein. 
C)  The 5ʹ cap and the poly(
A)  tail get removed prior to translation of the CFTR protein. 
D)  Methylation of the 5ʹ cap silences portions of the gene, preventing those regions from being transcribed into mRNA. 
E)  The mutation that causes cystic fibrosis creates a new terminator sequence, resulting in a shorter mRNA. 
A)  The promoter of the CFTR gene is likely silenced by miRNAs prior to mRNA production. 
B)  The CFTR gene likely has many introns that are excised prior to translation of the CFTR protein. 
C)  The 5ʹ cap and the poly(
A)  tail get removed prior to translation of the CFTR protein. 
D)  Methylation of the 5ʹ cap silences portions of the gene, preventing those regions from being transcribed into mRNA. 
E)  The mutation that causes cystic fibrosis creates a new terminator sequence, resulting in a shorter mRNA.

Question 6

What is the similarity between miRNAs, siRNAs, and piRNAs?

Accepted Answer

A)  All three types originate from transposons or viruses and are found in all organisms. 
B)  They all target and degrade the gene from which they were transcribed. 
C)  All three are generated from a single-stranded RNA that gets cleaved. 
D)  All three can influence chromatin structure, which, in turn, can influence gene expression. 
E)  All three associate with Piwi proteins in order to mediate RNA degradation. 
A)  All three types originate from transposons or viruses and are found in all organisms. 
B)  They all target and degrade the gene from which they were transcribed. 
C)  All three are generated from a single-stranded RNA that gets cleaved. 
D)  All three can influence chromatin structure, which, in turn, can influence gene expression. 
E)  All three associate with Piwi proteins in order to mediate RNA degradation.

Question 7

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT?

Accepted Answer

A)  Colinearity means that the linear nucleotide sequence of a given gene corresponds directly to the linear amino acid sequence in the corresponding polypeptide. 
B)  The number of nucleotides in a gene should be precisely proportional to the number of amino acids present in the corresponding polypeptide. 
C)  Colinearity generally holds true for the coding regions of prokaryotic viral genes. 
D)  The vast majority of eukaryotic genes follow the concept of colinearity. 
E)  The exception to colinearity between genes and polypeptides is the presence of untranslated sequences (UTRs). 
A)  Colinearity means that the linear nucleotide sequence of a given gene corresponds directly to the linear amino acid sequence in the corresponding polypeptide. 
B)  The number of nucleotides in a gene should be precisely proportional to the number of amino acids present in the corresponding polypeptide. 
C)  Colinearity generally holds true for the coding regions of prokaryotic viral genes. 
D)  The vast majority of eukaryotic genes follow the concept of colinearity. 
E)  The exception to colinearity between genes and polypeptides is the presence of untranslated sequences (UTRs).

Question 8

Given the figure below, within which of the following would the Shine-Dalgarno sequence be located?

Accepted Answer

A)  promoter 
B)  exon 1 
C)  exon 4 
D)  intron 1 
E)  A 5ʹ untranslated region would not be present in this figure. 
A)  promoter 
B)  exon 1 
C)  exon 4 
D)  intron 1 
E)  A 5ʹ untranslated region would not be present in this figure.

Question 9

Which of the following statements CORRECTLY describes the concept of alternative splicing?

Accepted Answer

A)  Eukaryotic gene and protein sequences are precisely colinear. 
B)  With the rare exception of RNA editing, every nucleotide contained in a processed mRNA molecule is derived from exon sequences. 
C)  Every other intron is removed in an alternate manner to generate a functional mRNA transcript. 
D)  Only a subset of the same mRNA transcripts is specifically selected for splicing in the nucleus. 
E)  Multiple protein products are often produced from single eukaryotic genes. 
A)  Eukaryotic gene and protein sequences are precisely colinear. 
B)  With the rare exception of RNA editing, every nucleotide contained in a processed mRNA molecule is derived from exon sequences. 
C)  Every other intron is removed in an alternate manner to generate a functional mRNA transcript. 
D)  Only a subset of the same mRNA transcripts is specifically selected for splicing in the nucleus. 
E)  Multiple protein products are often produced from single eukaryotic genes.

Question 10

Given the figure below, within which of the following would the 5ʹ untranslated region be located?

Accepted Answer

A)  promoter 
B)  exon 1 
C)  exon 4 
D)  intron 1 
E)  A 5ʹ untranslated region would not be present in this figure. 
A)  promoter 
B)  exon 1 
C)  exon 4 
D)  intron 1 
E)  A 5ʹ untranslated region would not be present in this figure.

Question 11

Use the pre-mRNA sequence shown below to answer the following questions.
mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'
a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided.
b. Predict what would happen if the G in the 5' splice site were mutated to a C.
c. We learned in this chapter that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation? How can you experimentally demonstrate that a 5' cap is important for this process?

Accepted Answer

a. The 5'splice site is ACUGGACAGGUAAGAA

Question 12

Scientists once believed that each gene can encode a single polypeptide. We now know that _____ and _____ allow a single gene to encode more than one polypeptide.

Accepted Answer

A)  transcription; translation 
B)  polyadenylation; RNA transport 
C)  DNA methylation; chromatin condensation 
D)  alternative processing; RNA editing 
E)  gene silencing; RNA interference 
A)  transcription; translation 
B)  polyadenylation; RNA transport 
C)  DNA methylation; chromatin condensation 
D)  alternative processing; RNA editing 
E)  gene silencing; RNA interference

Question 13

Which of the following is found in the primary product of transcription but not in a mature mRNA molecule?

Accepted Answer

A)  start codon 
B)  promoter 
C)  exons 
D)  introns 
E)  stop codon 
A)  start codon 
B)  promoter 
C)  exons 
D)  introns 
E)  stop codon

Question 14

Which of the following statements about group I and group II introns is NOT true?

Accepted Answer

A)  Both group I and II introns form elaborate and characteristic secondary structures with loops. 
B)  The splicing mechanism of group II introns is similar to that of spliceosome-mediated nuclear pre-mRNA splicing. 
C)  The length of group I and group II introns is much longer than the exons within the structures. 
D)  Group I and group II introns are exclusively found in mitochondrial and chloroplast encoded genes. 
E)  Both group I and group II introns are both found in bacterial genes. 
A)  Both group I and II introns form elaborate and characteristic secondary structures with loops. 
B)  The splicing mechanism of group II introns is similar to that of spliceosome-mediated nuclear pre-mRNA splicing. 
C)  The length of group I and group II introns is much longer than the exons within the structures. 
D)  Group I and group II introns are exclusively found in mitochondrial and chloroplast encoded genes. 
E)  Both group I and group II introns are both found in bacterial genes.

Question 15

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

Accepted Answer

A)  5' ACUGGACAGUCGGCACCACG 3' 
B)  5' GUAAGAAUACAAC 3' 
C)  5' UGACCUGUCAGCCGUGGUGC 3' 
D)  5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' 
E)  5'AGAAUACAACACAGUCGGCACCACG 3' 
A)  5' ACUGGACAGUCGGCACCACG 3' 
B)  5' GUAAGAAUACAAC 3' 
C)  5' UGACCUGUCAGCCGUGGUGC 3' 
D)  5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' 
E)  5'AGAAUACAACACAGUCGGCACCACG 3'

The spliceosome is a large, ribonucleoprotein complex located in the:

In your own words, list a comprehensive definition for "gene" at the molecular level.

During the posttranscriptional processing of pre-mRNA, a 5' cap is added to an mRNA in step-by-step manner. Which of the following reasons prevents the 5'capping process, involving methylation, from occurring on a DNA strand?

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation?

Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene comprises approximately 190,000 nucleotides and produces an mRNA of 6128 nucleotides in length. What is a possible explanation for the difference in the sizes of the gene and the mRNA?

What is the similarity between miRNAs, siRNAs, and piRNAs?

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT?

Given the figure below, within which of the following would the Shine-Dalgarno sequence be located?

Which of the following statements CORRECTLY describes the concept of alternative splicing?

Given the figure below, within which of the following would the 5ʹ untranslated region be located?

Scientists once believed that each gene can encode a single polypeptide. We now know that _ and _ allow a single gene to encode more than one polypeptide.

Which of the following is found in the primary product of transcription but not in a mature mRNA molecule?

Which of the following statements about group I and group II introns is NOT true?

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

Introduction to Genetics

Chromosomes and Cellular Reproduction

Basic Principles of Heredity

Sex Determination and Sex-Linked Characteristics

Extensions and Modifications of Basic Principles

Pedigree Analysis, Applications, and Genetic Testing

Linkage, Recombination, and Eukaryotic Gene Mapping

Chromosome Variation

Bacterial and Viral Genetic Systems

DNA: the Chemical Nature of the Gene

Chromosome Structure and Organelle Dna

DNA Replication and Recombination

Transcription

The Genetic Code and Translation

Control of Gene Expression in Prokaryotes

Control of Gene Expression in Eukaryotes

Gene Mutations and Dna Repair

Molecular Genetic Analysis and Biotechnology

Genomics and Proteomics

Epigenetics

Developmental Genetics and Immunogenetics

Cancer Genetics

Quantitative Genetics

Population Genetics

Evolutionary Genetics

Filters

Exam 14: Rna Molecules and Rna Processing

The spliceosome is a large, ribonucleoprotein complex located in the:

In your own words, list a comprehensive definition for "gene" at the molecular level.

During the posttranscriptional processing of pre-mRNA, a 5' cap is added to an mRNA in step-by-step manner. Which of the following reasons prevents the 5'capping process, involving methylation, from occurring on a DNA strand?

The 5ʹ cap in an mRNA plays a role in translation initiation. Which of the following could be a plausible mechanism by which a 5ʹ cap could enhance initiation?

Cystic fibrosis is caused by a mutation in the CFTR gene. The normal CFTR gene comprises approximately 190,000 nucleotides and produces an mRNA of 6128 nucleotides in length. What is a possible explanation for the difference in the sizes of the gene and the mRNA?

What is the similarity between miRNAs, siRNAs, and piRNAs?

In 1958, Francis Crick proposed that genes and their corresponding polypeptides are "colinear." Which of the following statements concerning the concept of colinearity is INCORRECT?

Given the figure below, within which of the following would the Shine-Dalgarno sequence be located?

Which of the following statements CORRECTLY describes the concept of alternative splicing?

Given the figure below, within which of the following would the 5ʹ untranslated region be located?

Scientists once believed that each gene can encode a single polypeptide. We now know that _____ and _____ allow a single gene to encode more than one polypeptide.

Which of the following is found in the primary product of transcription but not in a mature mRNA molecule?

Which of the following statements about group I and group II introns is NOT true?

The sequence below represents a pre-mRNA. Which of the following represents the sequence of the spliced mRNA that would result from this pre-mRNA sequence? mRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3'

Introduction to Genetics

Chromosomes and Cellular Reproduction

Basic Principles of Heredity

Sex Determination and Sex-Linked Characteristics

Extensions and Modifications of Basic Principles

Pedigree Analysis, Applications, and Genetic Testing

Linkage, Recombination, and Eukaryotic Gene Mapping

Chromosome Variation

Bacterial and Viral Genetic Systems

DNA: the Chemical Nature of the Gene

Chromosome Structure and Organelle Dna

DNA Replication and Recombination

Transcription

The Genetic Code and Translation

Control of Gene Expression in Prokaryotes

Control of Gene Expression in Eukaryotes

Gene Mutations and Dna Repair

Molecular Genetic Analysis and Biotechnology

Genomics and Proteomics

Epigenetics

Developmental Genetics and Immunogenetics

Cancer Genetics

Quantitative Genetics

Population Genetics

Evolutionary Genetics

Filters

Scientists once believed that each gene can encode a single polypeptide. We now know that _ and _ allow a single gene to encode more than one polypeptide.