Question 1

The Shine-Dalgarno sequence is found in eukaryotic cells.

Accepted Answer

A) True 
 B)False  False

Question 2

The first person to suggest that a connection exists between the function of a gene and the production
of an enzyme was Archibald Garrod.

Accepted Answer

A) True 
 B)False  True

Question 3

Raney nickel converts cysteine to what?

Accepted Answer

A)  Glycine 
B)  Asparagine 
C)  Alanine 
D)  Serine 
A)  Glycine 
B)  Asparagine 
C)  Alanine 
D)  Serine C

Question 4

The genetic code is universal in nuclear DNA from bacteria to mammals.

Accepted Answer

A) True 
 B)False

Question 5

Where does mRNA/tRNA codon-anticodon recognition take place?

Accepted Answer

A)  30S 
B)  40S 
C)  50S 
D)  The surface between the two ribosomal subunits 
A)  30S 
B)  40S 
C)  50S 
D)  The surface between the two ribosomal subunits

Question 6

The one-gene, one-enzyme hypothesis was first proposed by Beadle and Tatum.

Accepted Answer

A) True 
 B)False

Question 7

Where are the ribosomal subunits assembled?

Accepted Answer

A)  Nucleus 
B)  Nucleoid 
C)  Nucleolus 
D)  Nuclear envelope 
A)  Nucleus 
B)  Nucleoid 
C)  Nucleolus 
D)  Nuclear envelope

Question 8

The peptidyltransferase complex is a component of which of the following?

Accepted Answer

A)  DNA 
B)  tRNA 
C)  The ribosome 
D)  The functional protein 
E)  mRNA 
A)  DNA 
B)  tRNA 
C)  The ribosome 
D)  The functional protein 
E)  mRNA

Question 9

The C-terminal of a polypeptide always contains which of the following?

Accepted Answer

A)  A stop codon 
B)  A carboxyl group 
C)  An amino group 
D)  Carbon dioxide 
E)  None of the answers are correct 
A)  A stop codon 
B)  A carboxyl group 
C)  An amino group 
D)  Carbon dioxide 
E)  None of the answers are correct

Question 10

The wobble base is usually associated with the second base of a codon.

Accepted Answer

A) True 
 B)False

Question 11

Proteins that are composed of two or more subunits or polypeptides are said the have quanternary
structure.

Accepted Answer

A) True 
 B)False

Question 12

Frequently, the start codon for the functional protein is not at the 5' end of the mRNA. In fact, there are often several codons 5' of the start codon in an edited mRNA prior to translation. What is the purpose of these codons in a eukaryotic system?

Accepted Answer

A)  Ribosomal binding sites 
B)  Act as a promoter 
C)  Serve as sorting or traffic signals for the ribosome 
D)  Sites of spliceosome activity 
A)  Ribosomal binding sites 
B)  Act as a promoter 
C)  Serve as sorting or traffic signals for the ribosome 
D)  Sites of spliceosome activity

Question 13

All mature polypeptides contain a methionine at the N-terminus.

Accepted Answer

A) True 
 B)False

Question 14

Which of the following codons is not degenerate to CUU?

Accepted Answer

A)  CUC 
B)  UUG 
C)  CUA 
D)  AUU 
E)  UUA 
A)  CUC 
B)  UUG 
C)  CUA 
D)  AUU 
E)  UUA

Question 15

What is the modern theory of genetics?

Accepted Answer

A)  One gene-one enzyme 
B)  One gene-one polypeptide 
C)  One gene-various number of enzymes 
D)  No relationship can be determined between genes and proteins 
A)  One gene-one enzyme 
B)  One gene-one polypeptide 
C)  One gene-various number of enzymes 
D)  No relationship can be determined between genes and proteins

Question 16

a-helices and b-sheets are examples of what level of protein structure?

Accepted Answer

A)  Primary structure 
B)  Secondary structure 
C)  Tertiary structure 
D)  Quanternary structure 
A)  Primary structure 
B)  Secondary structure 
C)  Tertiary structure 
D)  Quanternary structure

Question 17

How many polypeptides are coded for by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

Accepted Answer

A)  7 
B)  8 
C)  10 
D)  13 
A)  7 
B)  8 
C)  10 
D)  13

Question 18

RF1 and RF2 are active during .

Accepted Answer

A)  Initiation 
B)  Elongation 
C)  Termination 
D)  Cotranslational import 
A)  Initiation 
B)  Elongation 
C)  Termination 
D)  Cotranslational import

Question 19

Which of the following is true according to the adaptor hypothesis?

Accepted Answer

A)  The anticodon and amino acid have no relationship 
B)  A given tRNA can carry any of the twenty amino acids 
C)  tRNA binds to mRNA at the ribosome 
D)  An amino acid recognizes the codon in mRNA 
A)  The anticodon and amino acid have no relationship 
B)  A given tRNA can carry any of the twenty amino acids 
C)  tRNA binds to mRNA at the ribosome 
D)  An amino acid recognizes the codon in mRNA

Question 20

The anticodon on the mRNA recognizes the codon on the tRNA.
FALSE

Accepted Answer

A) True 
 B)False

Exam 13: Translation of Mrna

The Shine-Dalgarno sequence is found in eukaryotic cells.

The first person to suggest that a connection exists between the function of a gene and the production of an enzyme was Archibald Garrod.

Raney nickel converts cysteine to what?

The genetic code is universal in nuclear DNA from bacteria to mammals.

Where does mRNA/tRNA codon-anticodon recognition take place?

The one-gene, one-enzyme hypothesis was first proposed by Beadle and Tatum.

Where are the ribosomal subunits assembled?

The peptidyltransferase complex is a component of which of the following?

The C-terminal of a polypeptide always contains which of the following?

The wobble base is usually associated with the second base of a codon.

Proteins that are composed of two or more subunits or polypeptides are said the have quanternary structure.

Frequently, the start codon for the functional protein is not at the 5' end of the mRNA. In fact, there are often several codons 5' of the start codon in an edited mRNA prior to translation. What is the purpose of these codons in a eukaryotic system?

All mature polypeptides contain a methionine at the N-terminus.

Which of the following codons is not degenerate to CUU?

What is the modern theory of genetics?

a-helices and b-sheets are examples of what level of protein structure?

How many polypeptides are coded for by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

RF1 and RF2 are active during .

Which of the following is true according to the adaptor hypothesis?

The anticodon on the mRNA recognizes the codon on the tRNA. FALSE

Overview of Genetics

Mendelian Inheritance

Reproduction and Chromosome Transmission

Extensions of Mendelian Inheritance

Non-Mendelian Inheritance

Genetic Linkage and Mapping in Eukaryotes

Genetic Transfer and Mapping in Bacteria and

Variation in Chromosome Structure and Number

Molecular Structure of Dna and Rna

Chromosome Organization and Molecular Structure

Dna Replication

Gene Transcription and Rna Modification

Gene Regulation in Bacteria and Bacteriophages

Gene Regulation in Eukaryotes

Gene Mutation and Dna Repair

Recombination and Transposition at the Molecular

Recombinant Dna Technology

Biotechnology

Genomics I: Analysis of Dna

Genomics II: Functional Genomics, Proteomics, and

Medical Genetics and Cancer

Developmental Genetics

Population Genetics

Quantitative Genetics

Evolutionary Genetics

Filters