Question 1

Once the amino acid on the second tRNA bonds with the amino acid of the first tRNA, what happens to that first tRNA?

Accepted Answer

A)  I t remains attached to the rRNA. 
B)  I t moves into the nucleus to get more instructions from mRNA. 
C)  I t breaks down into its component nucleotides. 
D)  I t leaves the ribosome and may pick up another amino acid. 
E)  I t transforms into an mRNA molecule. 
A)  I t remains attached to the rRNA. 
B)  I t moves into the nucleus to get more instructions from mRNA. 
C)  I t breaks down into its component nucleotides. 
D)  I t leaves the ribosome and may pick up another amino acid. 
E)  I t transforms into an mRNA molecule.

Question 2

Heritable changes in gene expression not due to changes in DNA sequences are known as _____.

Accepted Answer

A)  epigenetics 
B)  methylation 
C)  translational mutation 
D)  differentiation 
E)  frameshift inheritance 
A)  epigenetics 
B)  methylation 
C)  translational mutation 
D)  differentiation 
E)  frameshift inheritance

Question 3

The master gene that controls eye development in all multicellular eukaryotes is an example of a(n) _____.

Accepted Answer

A)  homeotic gene 
B)  conserved protein 
C)  RNA enzyme 
D)  Barr body 
E)  translation factor 
A)  homeotic gene 
B)  conserved protein 
C)  RNA enzyme 
D)  Barr body 
E)  translation factor

Question 4

Female secondary sexual traits, such as functional breasts and fat deposits around the hips and thighs, are determined by _____.

Accepted Answer

A)  the presence of the master gene, SRY 
B)  increased concentration of gene products from the two X chromosomes 
C)  absence of gene products from the Y chromosome 
D)  sex hormones 
E)  maternal influence 
A)  the presence of the master gene, SRY 
B)  increased concentration of gene products from the two X chromosomes 
C)  absence of gene products from the Y chromosome 
D)  sex hormones 
E)  maternal influence

Question 5

Which enzyme unwinds the DNA during transcription?

Accepted Answer

A)  helicase 
B)  DNA polymerase 
C)  DNA replicase 
D)  RNA polymerase 
E)  RNA replicase 
A)  helicase 
B)  DNA polymerase 
C)  DNA replicase 
D)  RNA polymerase 
E)  RNA replicase

Question 6

Mutations at intron-exon splice sites in DNA can lead to a(n) _____.

Accepted Answer

A)  short or truncated protein 
B)  protein that has a change in polarity 
C)  change in hydrophobicity 
D)  unspliced mRNA 
E)  mRNA that cannot be translated 
A)  short or truncated protein 
B)  protein that has a change in polarity 
C)  change in hydrophobicity 
D)  unspliced mRNA 
E)  mRNA that cannot be translated

Question 7

Translation stops when _____.

Accepted Answer

A)  enzymes attach to the mRNA molecule at the end of the transcript 
B)  a certain number of codons have been read 
C)  one of the three stop codons is encountered 
D)  the cell runs out of tRNA 
E)  stop codon tRNAs add guanine caps to the newly formed peptide 
A)  enzymes attach to the mRNA molecule at the end of the transcript 
B)  a certain number of codons have been read 
C)  one of the three stop codons is encountered 
D)  the cell runs out of tRNA 
E)  stop codon tRNAs add guanine caps to the newly formed peptide

Question 8

tRNA differs from other types of RNA because it _____.

Accepted Answer

A)  acts as an enzyme 
B)  is only involved in transcription 
C)  binds to mRNA 
D)  codes for multiple amino acids 
E)  is complexed with a protein 
A)  acts as an enzyme 
B)  is only involved in transcription 
C)  binds to mRNA 
D)  codes for multiple amino acids 
E)  is complexed with a protein

Question 9

Ricin is a toxin found in _____.

Accepted Answer

A)  canola-oil seeds 
B)  castor-oil seeds 
C)  gypsum-weed seeds 
D)  sesame seeds 
E)  sunflower seeds 
A)  canola-oil seeds 
B)  castor-oil seeds 
C)  gypsum-weed seeds 
D)  sesame seeds 
E)  sunflower seeds

Question 10

Mutations in an exon region of a gene are most likely to _____.

Accepted Answer

A)  prevent mRNA from being synthesized 
B)  trap mRNA inside the nucleus 
C)  prevent mRNA from being recognized by the ribosome 
D)  prevent mRNA from being post-transcriptionally modified 
E)  alter the amino acid sequence 
A)  prevent mRNA from being synthesized 
B)  trap mRNA inside the nucleus 
C)  prevent mRNA from being recognized by the ribosome 
D)  prevent mRNA from being post-transcriptionally modified 
E)  alter the amino acid sequence

Question 11

Which molecule initiates translation after an egg is fertilized?

Accepted Answer

A)  maternal mRNA 
B)  paternal promoters in sperm 
C)  maternal transcription factors 
D)  transposable elements 
E)  paternal DNA 
A)  maternal mRNA 
B)  paternal promoters in sperm 
C)  maternal transcription factors 
D)  transposable elements 
E)  paternal DNA

Question 12

How many different codons are part of the genetic code?

Accepted Answer

A)  4 
B)  16 
C)  32 
D)  64 
E)  128 
A)  4 
B)  16 
C)  32 
D)  64 
E)  128

Question 13

In this representation of transcription, strand # ____ is ____ because it ____.

Accepted Answer

A)  2; RNA; is double-stranded 
B)  3; RNA; contains uracil 
C)  2; RNA; contains thymine 
D)  2; RNA; has no uracil 
E)  3; DNA; contains adenine 
A)  2; RNA; is double-stranded 
B)  3; RNA; contains uracil 
C)  2; RNA; contains thymine 
D)  2; RNA; has no uracil 
E)  3; DNA; contains adenine

Question 14

Match between columns
                        Premises: The mutation in the keratin gene in sphynx cats causes a change in the intron-exon splice site and is an example of which type of mutation?
What type of mutation occurred if the sequence GGACTCCTCCTCAGA is changed to GGACTCCTTCCTCAGA?
If UUA codes for leucine (leu), UUU codes for phenylalanine (phe), AUU codes for isoleucine (iso), AAA codes for asparagine (asn), and UAA codes for a stop codon, which type of mutation would be responsible for changing the protein sequence from leu-phe-iso-iso-stop to leu-phe-leu-phe-asn-stop?
Which type of mutation replaces glutamic acid with valine in beta globin proteins in individuals with sickle-cell anemia?
A deletion in the beta globin gene leads to this type of mutation, causing beta-thalassemia.
What type of mutation is least likely to alter the amino acid sequence?

Accepted Answer

The Answer of i nsertion only and d eletion only is...

Question 15

Most of the energy required to form the peptide bonds during elongation comes from _____.

Accepted Answer

A)  ATP 
B)  CTP 
C)  GTP 
D)  TTP 
E)  whichever nucleotide is at the front of the codon 
A)  ATP 
B)  CTP 
C)  GTP 
D)  TTP 
E)  whichever nucleotide is at the front of the codon

Question 16

In most species, all mRNA transcripts begin with _____.

Accepted Answer

A)  methionine 
B)  a ribosome 
C)  AUG 
D)  the P site 
E)  an anticodon 
A)  methionine 
B)  a ribosome 
C)  AUG 
D)  the P site 
E)  an anticodon

Question 17

Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

Accepted Answer

A)  asp-gly-val-glu-glu-trp-tyr 
B)  leu-pro-glu-leu-leu-thr-ile 
C)  ile-thr-leu-leu-gly-pro-leu 
D)  ser-arg-arg-met-gly-val-stop 
E)  met-gly-val-lys-ser-gly-stop 
A)  asp-gly-val-glu-glu-trp-tyr 
B)  leu-pro-glu-leu-leu-thr-ile 
C)  ile-thr-leu-leu-gly-pro-leu 
D)  ser-arg-arg-met-gly-val-stop 
E)  met-gly-val-lys-ser-gly-stop

Question 18

What is at the center of a heme molecule in a hemoglobin protein?

Accepted Answer

A)  a beta globin chain 
B)  an alpha globin chain 
C)  iron 
D)  nitrogen 
E)  another heme molecule 
A)  a beta globin chain 
B)  an alpha globin chain 
C)  iron 
D)  nitrogen 
E)  another heme molecule

Question 19

In a sickled red blood cell, what do the hemoglobin molecules do?

Accepted Answer

A)  repel each other 
B)  stick together 
C)  fracture and release their contents into the cytoplasm 
D)  create holes in the cell membrane 
E)  hold less tightly onto oxygen molecules 
A)  repel each other 
B)  stick together 
C)  fracture and release their contents into the cytoplasm 
D)  create holes in the cell membrane 
E)  hold less tightly onto oxygen molecules

Question 20

During transcription, _____.

Accepted Answer

A)  noncoding sequences are removed from the RNA transcript 
B)  regulatory proteins attach to the DNA at the promoter site 
C)  DNA polymerase assembles RNA nucleotides 
D)  the entire DNA strand opens up for complete gene transcription 
E)  tRNA brings nucleotides to the DNA strand 
A)  noncoding sequences are removed from the RNA transcript 
B)  regulatory proteins attach to the DNA at the promoter site 
C)  DNA polymerase assembles RNA nucleotides 
D)  the entire DNA strand opens up for complete gene transcription 
E)  tRNA brings nucleotides to the DNA strand

Exam 8: Gene Expression and Control

Once the amino acid on the second tRNA bonds with the amino acid of the first tRNA, what happens to that first tRNA?

Heritable changes in gene expression not due to changes in DNA sequences are known as _____.

The master gene that controls eye development in all multicellular eukaryotes is an example of a(n) _____.

Female secondary sexual traits, such as functional breasts and fat deposits around the hips and thighs, are determined by _____.

Which enzyme unwinds the DNA during transcription?

Mutations at intron-exon splice sites in DNA can lead to a(n) _____.

Translation stops when _____.

tRNA differs from other types of RNA because it _____.

Ricin is a toxin found in _____.

Mutations in an exon region of a gene are most likely to _____.

Which molecule initiates translation after an egg is fertilized?

How many different codons are part of the genetic code?

In this representation of transcription, strand # ____ is ____ because it ____.

Most of the energy required to form the peptide bonds during elongation comes from _____.

In most species, all mRNA transcripts begin with _____.

Referring to the given image, what is the amino acid sequence that is coded for by the DNA sequence GATGGACTTGAAGAGTGGTAA?

What is at the center of a heme molecule in a hemoglobin protein?

In a sickled red blood cell, what do the hemoglobin molecules do?

During transcription, _____.

Invitation to Biology

Molecules of Life

Cell Structure

Energy and Metabolism

Photosynthesis

Releasing Chemical Energy

Dna Structure and Function

How Cells Reproduce

Patterns of Inheritance

Biotechnology

Evidence of Evolution

Processes of Evolution

Prokaryotes, Protists, and Viruses

Plants and Fungi

Animal Evolution

Population Ecology

Communities and Ecosystems

The Biosphere and Human Effects

Animal Tissues and Organs

How Animals Move

Circulation and Respiration

Immunity

Digestion and Excretion

Neural Control and the Senses

Endocrine Control

Animal Reproduction and Development

Plant Form and Function

Life Cycles of Flowering Plants

Filters

In this representation of transcription, strand # is because it .