Question 1

Which of the following would not alter a gene's frequency in a population?

Accepted Answer

A) mutation 
B) migration 
C) random mating 
D) inbreeding 
A) mutation 
B) migration 
C) random mating 
D) inbreeding C

Question 2

To compensate for the barriers to implementing DNA profiling in mass disasters,Sir Alec Jeffreys advises assessing _____ STRs.

Accepted Answer

A) 15 to 20 
B) 20 to 35 
C) 25 to 30 
D) 40 to 50 
A) 15 to 20 
B) 20 to 35 
C) 25 to 30 
D) 40 to 50 A

Question 3

DNA on a glove left at the crime scene is an example of primary DNA transfer.

Accepted Answer

A) True 
 B)False  True

Question 4

A common source of DNA for forensic testing is

Accepted Answer

A) the skin between the toes. 
B) cells scraped from inside the cheek. 
C) red blood cells. 
D) mucus. 
A) the skin between the toes. 
B) cells scraped from inside the cheek. 
C) red blood cells. 
D) mucus.

Question 5

Capillary electrophoresis is a technique used to separate DNA pieces.

Accepted Answer

A) True 
 B)False

Question 6

Gene flow is the

Accepted Answer

A) migration of individuals between populations. 
B) transfer of genes within a population. 
C) variation of alleles within a population. 
D) movement of alleles between populations. 
A) migration of individuals between populations. 
B) transfer of genes within a population. 
C) variation of alleles within a population. 
D) movement of alleles between populations.

Question 7

The parts of the genome that are used in markers of identity in DNA profiling

Accepted Answer

A) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
B) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype. 
C) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
D) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype. 
A) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
B) are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype. 
C) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
D) are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype.

Question 8

The difference between microevolution and macroevolution is that

Accepted Answer

A) microevolution affects bacteria and macroevolution affects larger organisms. 
B) microevolution happens slowly and macroevolution happens quickly. 
C) macroevolution happens slowly and microevolution happens quickly. 
D) microevolutionary changes are small,and macroevolutionary changes are large. 
A) microevolution affects bacteria and macroevolution affects larger organisms. 
B) microevolution happens slowly and macroevolution happens quickly. 
C) macroevolution happens slowly and microevolution happens quickly. 
D) microevolutionary changes are small,and macroevolutionary changes are large.

Question 9

DNA profiling was less useful in identifying remains from the 2004 tsunami than in criminal cases because

Accepted Answer

A) the DNA after the tsunami was too wet to analyze. 
B) the tsunami left few bodies with collectible DNA. 
C) not enough repeats were profiled. 
D) none of the victims were listed in the FBI's files. 
A) the DNA after the tsunami was too wet to analyze. 
B) the tsunami left few bodies with collectible DNA. 
C) not enough repeats were profiled. 
D) none of the victims were listed in the FBI's files.

Question 10

For a very rare inherited disease,the frequency of heterozygotes in a population is

Accepted Answer

A) half that of the dominant allele. 
B) double that of the recessive allele. 
C) very close to 0. 
D) near 1. 
A) half that of the dominant allele. 
B) double that of the recessive allele. 
C) very close to 0. 
D) near 1.

Question 11

Hardy-Weinberg equilibrium is possible only if the population is

Accepted Answer

A) small,with no migration out or in,and females outnumbering males. 
B) large,with random mating and no migration,mutation,genetic drift,or natural selection. 
C) small,with nonrandom mating and no migration,mutation,genetic drift,or artificial selection. 
D) large,with nonrandom mating,mutation,genetic drift,and natural selection. 
A) small,with no migration out or in,and females outnumbering males. 
B) large,with random mating and no migration,mutation,genetic drift,or natural selection. 
C) small,with nonrandom mating and no migration,mutation,genetic drift,or artificial selection. 
D) large,with nonrandom mating,mutation,genetic drift,and natural selection.

Question 12

Which group is used to calculate the frequency of an allele in a population?

Accepted Answer

A) Homozygous recessives 
B) The most fertile individuals 
C) Autosomal dominants 
D) Heterozygotes 
A) Homozygous recessives 
B) The most fertile individuals 
C) Autosomal dominants 
D) Heterozygotes

Question 13

Which of the following have the longest DNA sequences?

Accepted Answer

A) VNTRs 
B) STRs 
C) Thymine dimers 
D) Base pairs 
A) VNTRs 
B) STRs 
C) Thymine dimers 
D) Base pairs

Question 14

Who invented DNA profiling?

Accepted Answer

A) Godfrey Hardy 
B) William Weinberg 
C) Sir Alec Jeffreys 
D) Linus Pauling 
A) Godfrey Hardy 
B) William Weinberg 
C) Sir Alec Jeffreys 
D) Linus Pauling

Question 15

VNTRs and STRs differ in that

Accepted Answer

A) a VNTR repeat is shorter than an STR repeat. 
B) a VNTR repeat is longer than an STR repeat. 
C) a VNTR is a type of copy number variant and an STR is not. 
D) an STR is a type of copy number variant and a VNTR is not. 
A) a VNTR repeat is shorter than an STR repeat. 
B) a VNTR repeat is longer than an STR repeat. 
C) a VNTR is a type of copy number variant and an STR is not. 
D) an STR is a type of copy number variant and a VNTR is not.

Question 16

Familial DNA search was used in the case of California's "Grim Sleeper."

Accepted Answer

A) True 
 B)False

Question 17

Combined DNA Index System (CODIS)is

Accepted Answer

A) a fifteen-base DNA sequence used in DNA profiling. 
B) a type of mutation used in forensic applications. 
C) a system for crime laboratories to share DNA profiles. 
D) a technology used to amplify DNA found at crime scenes. 
A) a fifteen-base DNA sequence used in DNA profiling. 
B) a type of mutation used in forensic applications. 
C) a system for crime laboratories to share DNA profiles. 
D) a technology used to amplify DNA found at crime scenes.

Question 18

DNA analysis to determine genetic identity applies

Accepted Answer

A) Mendel's law of independent assortment and the product rule. 
B) Mendel's law of segregation and the product rule. 
C) the law of polymorphism. 
D) Darwin's mathematical principles. 
A) Mendel's law of independent assortment and the product rule. 
B) Mendel's law of segregation and the product rule. 
C) the law of polymorphism. 
D) Darwin's mathematical principles.

Question 19

Frequency of an X-linked recessive allele in males equals

Accepted Answer

A) p2. 
B) 2pq. 
C) q2. 
D) q. 
A) p2. 
B) 2pq. 
C) q2. 
D) q.

Question 20

The DNA sequence GATCTGATCTGATCTGATCT is a(n)

Accepted Answer

A) VNTR. 
B) STR. 
C) RFLP. 
D) SNP. 
A) VNTR. 
B) STR. 
C) RFLP. 
D) SNP.

Exam 14: Constant Allele Frequencies

Which of the following would not alter a gene's frequency in a population?

To compensate for the barriers to implementing DNA profiling in mass disasters,Sir Alec Jeffreys advises assessing _____ STRs.

DNA on a glove left at the crime scene is an example of primary DNA transfer.

A common source of DNA for forensic testing is

Capillary electrophoresis is a technique used to separate DNA pieces.

Gene flow is the

The parts of the genome that are used in markers of identity in DNA profiling

The difference between microevolution and macroevolution is that

DNA profiling was less useful in identifying remains from the 2004 tsunami than in criminal cases because

For a very rare inherited disease,the frequency of heterozygotes in a population is

Hardy-Weinberg equilibrium is possible only if the population is

Which group is used to calculate the frequency of an allele in a population?

Which of the following have the longest DNA sequences?

Who invented DNA profiling?

VNTRs and STRs differ in that

Familial DNA search was used in the case of California's "Grim Sleeper."

Combined DNA Index System (CODIS)is

DNA analysis to determine genetic identity applies

Frequency of an X-linked recessive allele in males equals

The DNA sequence GATCTGATCTGATCTGATCT is a(n)

What Is in a Human Genome

Cells

Meiosis,Development and Aging

Single-Gene Inheritance

Beyond Mendels Laws

Matters of Sex

Multifactorial Traits

Genetics of Behavior

DNA Structure and Replication

Gene Action: From DNA to Protein

Gene Expression and Epigenetics

Gene Mutation

Chromosomes

Changing Allele Frequencies

Human Ancestry and Evolution

Genetics of Immunity

Cancer Genetics and Genomics

Genetic Technologies: Patenting, modifying, and Monitoring Dna

Genetic Testing and Treatment

Reproductive Technologies

Genomics

Filters