Question 1

Which amino acid is encoded by four synonymous codons?

Accepted Answer

A) MET 
B) VAL 
C) PHE 
D) CYS 
E) ILE 
A) MET 
B) VAL 
C) PHE 
D) CYS 
E) ILE B

Question 2

Process 2 represents:

Accepted Answer

A) replication. 
B) transcription. 
C) translation. 
D) RNA processing. 
E) RNA interference. 
A) replication. 
B) transcription. 
C) translation. 
D) RNA processing. 
E) RNA interference. C

Question 3

Is the below sequence RNA or DNA? How can you tell?
5' ...GGAGCUCGUUGUAUU...3'

Accepted Answer

It is RNA because it contains the nitrogenous base uracil (U), and does not contain thymine(T).

Question 4

Which of the following statements about translation is CORRECT?

Accepted Answer

A) A special tRNA that does not have an attached amino acid binds to stop codons to terminate translation. 
B) The first three bases at the 5'end of an mRNA are the AUG at which translation begins. 
C) The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end. 
D) In eukaryotes, the 5' cap and the 3' poly(
A) tail are involved in translation initiation. 
E) Ribosomes move along an mRNA in the 3'to 5' direction. 
A) A special tRNA that does not have an attached amino acid binds to stop codons to terminate translation. 
B) The first three bases at the 5'end of an mRNA are the AUG at which translation begins. 
C) The codon for methionine appears only at the beginning of the mRNA for a protein, not in the middle or in the end. 
D) In eukaryotes, the 5' cap and the 3' poly(
A) tail are involved in translation initiation. 
E) Ribosomes move along an mRNA in the 3'to 5' direction.

Question 5

Compute how many (different)nucleotide sequences can encode the following tri-peptide, VAL-GLY-ARG?

Accepted Answer

A) 14 
B) 24 
C) 48 
D) 64 
E) 96 
A) 14 
B) 24 
C) 48 
D) 64 
E) 96

Question 6

The next step in the translation of this mRNA will be the formation of a peptide bond between which two amino acids?

Accepted Answer

A) Amino acid 2 and amino acid 3 
B) Amino acid 2 and amino acid 4 
C) Amino acid 1 and amino acid 3 
D) Amino acid 1 and amino acid 2 
E) Amino acid 3 and amino acid 4 
A) Amino acid 2 and amino acid 3 
B) Amino acid 2 and amino acid 4 
C) Amino acid 1 and amino acid 3 
D) Amino acid 1 and amino acid 2 
E) Amino acid 3 and amino acid 4

Question 7

An anticodon would be found on which of these molecules?

Accepted Answer

A) Amino acid 
B) mRNA 
C) DNA 
D) tRNA 
E) rRNA 
A) Amino acid 
B) mRNA 
C) DNA 
D) tRNA 
E) rRNA

Question 8

A bacterial protein is encoded by the following mRNA sequence: 5'-AUGGUGCUCAUGCCCTAA-3'
The second methionine codon (AUG)in this mRNA sequence will:

Accepted Answer

A) serve as the initiation codon. 
B) encode N-formylmethionine. 
C) encode methionine that will eventually be removed. 
D) encode unformylated methionine. 
E) be skipped as the translation progresses. 
A) serve as the initiation codon. 
B) encode N-formylmethionine. 
C) encode methionine that will eventually be removed. 
D) encode unformylated methionine. 
E) be skipped as the translation progresses.

Question 9

Although the genetic code is nearly universal, some variations do exist.In vertebrate mitochondria, UGA codes for Trp (instead of termination), AUA codes for Met (instead of Ile), and AGA and AGG are stop codons (instead of coding for Arg).Translate the following coding strand DNA sequences using both the standard code and the vertebrate mitochondrial code.
a.5' ATGGCCATAAGATGA 3'
b.5' ATGGGGGATCGCTAA 3'
c.5' ATGTGATGGCATCTTATAAATTGATAA 3'

Accepted Answer

a.Standard: MET-ALA-ILE-ARG; m

Question 10

Which of the following statements describes the "wobble" rules CORRECTLY?

Accepted Answer

A) There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids. 
B) The number of the genetic code exceeds the number of amino acids available in the cell. 
C) There are multiple tRNAs that may bind to the same amino acids. 
D) There are multiple codons that may code for the same amino acids. 
E) The third base pairing between the tRNA and mRNA is relaxed. 
A) There is a flexible pairing between tRNA and amino acid as there are more tRNAs than the number of amino acids. 
B) The number of the genetic code exceeds the number of amino acids available in the cell. 
C) There are multiple tRNAs that may bind to the same amino acids. 
D) There are multiple codons that may code for the same amino acids. 
E) The third base pairing between the tRNA and mRNA is relaxed.

Question 11

The genetic code is said to be "degenerate" because:

Accepted Answer

A) there are more codons than amino acids. 
B) there are more amino acids than codons. 
C) different organisms use different codons to encode the same amino acid. 
D) some codons specify more than one amino acid. 
E) there are more tRNAs than amino acids. 
A) there are more codons than amino acids. 
B) there are more amino acids than codons. 
C) different organisms use different codons to encode the same amino acid. 
D) some codons specify more than one amino acid. 
E) there are more tRNAs than amino acids.

Question 12

The function of aminoacyl-tRNA synthetases is to:

Accepted Answer

A) transcribe tRNA genes. 
B) match tRNA anticodons and mRNA codons at the ribosome. 
C) attach appropriate amino acids to corresponding tRNAs. 
D) form the peptide bond between amino acids at the ribosome. 
E) synthesize and transport amino acids to the ribosomes. 
A) transcribe tRNA genes. 
B) match tRNA anticodons and mRNA codons at the ribosome. 
C) attach appropriate amino acids to corresponding tRNAs. 
D) form the peptide bond between amino acids at the ribosome. 
E) synthesize and transport amino acids to the ribosomes.

Question 13

To translate an mRNA requires two other types of RNA.These are:

Accepted Answer

A) tRNA and mRNA. 
B) tRNA and miRNA. 
C) tRNA and rRNA. 
D) rRNA and siRNA. 
E) snRNA and snoRNA. 
A) tRNA and mRNA. 
B) tRNA and miRNA. 
C) tRNA and rRNA. 
D) rRNA and siRNA. 
E) snRNA and snoRNA.

Question 14

During initiation of translation:

Accepted Answer

A) the initiator tRNAmet binds to the A site of a ribosome. 
B) specific rRNA base pairs with a sequence in mRNA to position a ribosome at the start codon. 
C) IF-3 must be recruited to the 30S ribosome in order for the 70S initiation complex to assemble. 
D) there is no energy expenditure as the tRNA binding to mRNA is via complementary base pairing. 
E) both 70S and 30S ribosome subunits must simultaneously recognize an mRNA to bind. 
A) the initiator tRNAmet binds to the A site of a ribosome. 
B) specific rRNA base pairs with a sequence in mRNA to position a ribosome at the start codon. 
C) IF-3 must be recruited to the 30S ribosome in order for the 70S initiation complex to assemble. 
D) there is no energy expenditure as the tRNA binding to mRNA is via complementary base pairing. 
E) both 70S and 30S ribosome subunits must simultaneously recognize an mRNA to bind.

Question 15

If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is:

Accepted Answer

A) AUAGGCAGU. 
B) UCCCAGGUG. 
C) CACCUGGGA. 
D) AGGGUCCAC. 
E) GACAUUAGA. 
A) AUAGGCAGU. 
B) UCCCAGGUG. 
C) CACCUGGGA. 
D) AGGGUCCAC. 
E) GACAUUAGA.

Question 16

Which of the following codons is often used as an initiation codon?

Accepted Answer

A) UUU 
B) UUA 
C) AUU 
D) AUG 
E) AUC 
A) UUU 
B) UUA 
C) AUU 
D) AUG 
E) AUC

Question 17

This DNA sequence represents an open reading frame (ORF)of a transcriptional unit.Transcribe and then translate this gene in the spaces provided below.
5' ATGGGAGCTCGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'

Accepted Answer

(a)Transcribed mRNA sequence:

Question 18

A tRNA anticodon is 3'-GCU-5'.What amino acid does it carry?

Accepted Answer

A) Ala 
B) Arg 
C) Ser 
D) Pro 
E) Thr 
A) Ala 
B) Arg 
C) Ser 
D) Pro 
E) Thr

Question 19

A yeast strain was exposed to a chemical mutagen.As expected, exposure to the mutagen resulted in DNA sequence change in an essential gene you examined.Yet, this mutation did not result in any lethal phenotype.How could you explain this apparent discrepancy?

Accepted Answer

The DNA sequence change occurred in a sy

Question 20

An mRNA has the stop codon 5'UAA 3'.What tRNA anticodon will bind to it?

Accepted Answer

A) 5' ATT 3' 
B) 5'AUC 3' 
C) 5'ACU 3' 
D) 5' UUA 3' 
E) None 
A) 5' ATT 3' 
B) 5'AUC 3' 
C) 5'ACU 3' 
D) 5' UUA 3' 
E) None

Which amino acid is encoded by four synonymous codons?

Process 2 represents:

Is the below sequence RNA or DNA? How can you tell? 5' ...GGAGCUCGUUGUAUU...3'

Which of the following statements about translation is CORRECT?

Compute how many (different)nucleotide sequences can encode the following tri-peptide, VAL-GLY-ARG?

The next step in the translation of this mRNA will be the formation of a peptide bond between which two amino acids?

An anticodon would be found on which of these molecules?

A bacterial protein is encoded by the following mRNA sequence: 5'-AUGGUGCUCAUGCCCTAA-3' The second methionine codon (AUG)in this mRNA sequence will:

Which of the following statements describes the "wobble" rules CORRECTLY?

The genetic code is said to be "degenerate" because:

The function of aminoacyl-tRNA synthetases is to:

To translate an mRNA requires two other types of RNA.These are:

During initiation of translation:

If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is:

Which of the following codons is often used as an initiation codon?

This DNA sequence represents an open reading frame (ORF)of a transcriptional unit.Transcribe and then translate this gene in the spaces provided below. 5' ATGGGAGCTCGTTGTATTTGA 3' 3' TACCCTCGAGCAACATAAACT 5'

A tRNA anticodon is 3'-GCU-5'.What amino acid does it carry?

A yeast strain was exposed to a chemical mutagen.As expected, exposure to the mutagen resulted in DNA sequence change in an essential gene you examined.Yet, this mutation did not result in any lethal phenotype.How could you explain this apparent discrepancy?

An mRNA has the stop codon 5'UAA 3'.What tRNA anticodon will bind to it?

Introduction to Genetics

Chromosomes and Cellular Reproduction

Basic Principles of Heredity

Sex Determination and Sex-Linked Characteristics

Linkage, Recombination, and Eukaryotic Gene Mapping

Chromosome Variation

Bacterial and Viral Genetic Systems

DNA- the Chemical Nature of the Gene

DNA Replication and Recombination

From DNA to Proteins- Transcription and Rna Processing

Control of Gene Expression

Gene Mutations, Transposable Elements, and Dna Repair

Molecular Genetic Analysis and Biotechnology

Genomics and Proteomics

Cancer Genetics

Quantitative Genetics

Population and Evolutionary Genetics

Filters

Exam 11: From DNA to Protein- Translation

Which amino acid is encoded by four synonymous codons?

Process 2 represents:

Is the below sequence RNA or DNA? How can you tell? 5' ...GGAGCUCGUUGUAUU...3'

Which of the following statements about translation is CORRECT?

Compute how many (different)nucleotide sequences can encode the following tri-peptide, VAL-GLY-ARG?

The next step in the translation of this mRNA will be the formation of a peptide bond between which two amino acids?

An anticodon would be found on which of these molecules?

A bacterial protein is encoded by the following mRNA sequence: 5'-AUGGUGCUCAUGCCCTAA-3' The second methionine codon (AUG)in this mRNA sequence will:

Which of the following statements describes the "wobble" rules CORRECTLY?

The genetic code is said to be "degenerate" because:

The function of aminoacyl-tRNA synthetases is to:

To translate an mRNA requires two other types of RNA.These are:

During initiation of translation:

If the bottom strand of the DNA from the diagram above serves as the template strand, the RNA sequence, left to right 5' to 3', is:

Which of the following codons is often used as an initiation codon?

This DNA sequence represents an open reading frame (ORF)of a transcriptional unit.Transcribe and then translate this gene in the spaces provided below. 5' ATGGGAGCTCGTTGTATTTGA 3' 3' TACCCTCGAGCAACATAAACT 5'

A tRNA anticodon is 3'-GCU-5'.What amino acid does it carry?

A yeast strain was exposed to a chemical mutagen.As expected, exposure to the mutagen resulted in DNA sequence change in an essential gene you examined.Yet, this mutation did not result in any lethal phenotype.How could you explain this apparent discrepancy?

An mRNA has the stop codon 5'UAA 3'.What tRNA anticodon will bind to it?

Introduction to Genetics

Chromosomes and Cellular Reproduction

Basic Principles of Heredity

Sex Determination and Sex-Linked Characteristics

Linkage, Recombination, and Eukaryotic Gene Mapping

Chromosome Variation

Bacterial and Viral Genetic Systems

DNA- the Chemical Nature of the Gene

DNA Replication and Recombination

From DNA to Proteins- Transcription and Rna Processing

Control of Gene Expression

Gene Mutations, Transposable Elements, and Dna Repair

Molecular Genetic Analysis and Biotechnology

Genomics and Proteomics

Cancer Genetics

Quantitative Genetics

Population and Evolutionary Genetics

Filters