Question 1

Which is an accurate description of organelle genomes? (Select all that apply. )

Accepted Answer

A) Translation in mitochondria and chloroplasts is often inhibited by bacterial antibiotics (e.g. , chloramphenicol). 
B) Like bacteria, mitochondria use N-formyl methionine and tRNAfmet in translation. 
C) mtDNA and cpDNA are usually organized into nucleosomes by histones. 
D) Like bacterial genes, mitochondrial and chloroplast genes do not have introns. 
E) Like bacterial genomes, mitochondrial and chloroplast genomes in all species consist of one circular DNA molecule. 
A) Translation in mitochondria and chloroplasts is often inhibited by bacterial antibiotics (e.g. , chloramphenicol). 
B) Like bacteria, mitochondria use N-formyl methionine and tRNAfmet in translation. 
C) mtDNA and cpDNA are usually organized into nucleosomes by histones. 
D) Like bacterial genes, mitochondrial and chloroplast genes do not have introns. 
E) Like bacterial genomes, mitochondrial and chloroplast genomes in all species consist of one circular DNA molecule. A, B

Question 2

The codon UGA specifies

Accepted Answer

A) a stop signal in the universal genetic code and in human mtDNA. 
B) the amino acid tryptophan in the universal genetic code and in human mtDNA. 
C) formyl-methionine in mtDNA. 
D) a stop signal in the universal genetic code and the amino acid tryptophan in human mtDNA. 
A) a stop signal in the universal genetic code and in human mtDNA. 
B) the amino acid tryptophan in the universal genetic code and in human mtDNA. 
C) formyl-methionine in mtDNA. 
D) a stop signal in the universal genetic code and the amino acid tryptophan in human mtDNA. D

Question 3

Which has been associated with aging in humans?

Accepted Answer

A) an increase in the number of mitochondria 
B) no change in the sequence of the mitochondrial genome 
C) a decrease in mitochondrial function 
D) an increase in mitochondrial function 
A) an increase in the number of mitochondria 
B) no change in the sequence of the mitochondrial genome 
C) a decrease in mitochondrial function 
D) an increase in mitochondrial function C

Question 4

Researchers combined two yeast strains of opposite mating type; the a strain was resistant to chloramphenicol and the ? strain was sensitive to chloramphenicol. The diploid progeny were allowed to undergo several cell divisions, and then the cells were replica plated on glycerol medium with and without chloramphenicol.
-What results would you expect if mitochondria are inherited biparentally?

Accepted Answer

A) Some, but not all, yeast colonies found on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
B) All of the yeast colonies on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
C) Many yeast colonies will grow on the plate without chloramphenicol and no colonies will grow on the plate with chloramphenicol. 
D) No colonies will grow on either plate. 
A) Some, but not all, yeast colonies found on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
B) All of the yeast colonies on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
C) Many yeast colonies will grow on the plate without chloramphenicol and no colonies will grow on the plate with chloramphenicol. 
D) No colonies will grow on either plate.

Question 5

Why is a variegated plant considered heteroplasmic?

Accepted Answer

A) The plant has mutant and wild-type chloroplast DNAs distributed amongst the cells in different ratios. 
B) The plant has only two types of cells, one with only mutant chloroplast DNAs and one with only wild-type chloroplast DNAs. 
C) All of the plant's cells have mutant and wild-type chloroplast DNAs. 
D) All of the plant's cells have mitochondria and chloroplasts. 
A) The plant has mutant and wild-type chloroplast DNAs distributed amongst the cells in different ratios. 
B) The plant has only two types of cells, one with only mutant chloroplast DNAs and one with only wild-type chloroplast DNAs. 
C) All of the plant's cells have mutant and wild-type chloroplast DNAs. 
D) All of the plant's cells have mitochondria and chloroplasts.

Question 6

Inhibitors of bacterial translation, such as chloramphenicol and erythromycin, usually (Select all that apply. )

Accepted Answer

A) inhibit mitochondrial protein synthesis. 
B) inhibit chloroplast protein synthesis. 
C) inhibit eukaryotic cytoplasmic protein synthesis. 
D) have no effect on mitochondrial protein synthesis. 
E) have no effect on chloroplast protein synthesis. 
A) inhibit mitochondrial protein synthesis. 
B) inhibit chloroplast protein synthesis. 
C) inhibit eukaryotic cytoplasmic protein synthesis. 
D) have no effect on mitochondrial protein synthesis. 
E) have no effect on chloroplast protein synthesis.

Question 7

Extranuclear genes show a biparental inheritance pattern in yeast since

Accepted Answer

A) progeny from diploid vegetative growth can have the phenotype of the dominant phenotype. 
B) progeny from diploid vegetative growth can have the phenotype of the α parent. 
C) progeny from diploid vegetative growth can have the phenotype of only the a parent. 
D) progeny from diploid vegetative growth can have the phenotype of either the a or the α parent. 
A) progeny from diploid vegetative growth can have the phenotype of the dominant phenotype. 
B) progeny from diploid vegetative growth can have the phenotype of the α parent. 
C) progeny from diploid vegetative growth can have the phenotype of only the a parent. 
D) progeny from diploid vegetative growth can have the phenotype of either the a or the α parent.

Question 8

What would be the most likely result if a scientist removes mitochondria from a human cell and attempts to grow them in culture?

Accepted Answer

A) The mitochondria originated from a prokaryotic cell, so the mitochondria will grow independently in culture. 
B) Mitochondria require the products of nuclear genes to function, so the mitochondria will die soon after being removed from the cell. 
C) The mitochondria will continue to produce ATP indefinitely only if a source of pyruvate is provided. 
D) The mitochondria will grow more quickly in the presence of antibiotics that kill bacteria and reduce competition for resources with bacterial cells. 
A) The mitochondria originated from a prokaryotic cell, so the mitochondria will grow independently in culture. 
B) Mitochondria require the products of nuclear genes to function, so the mitochondria will die soon after being removed from the cell. 
C) The mitochondria will continue to produce ATP indefinitely only if a source of pyruvate is provided. 
D) The mitochondria will grow more quickly in the presence of antibiotics that kill bacteria and reduce competition for resources with bacterial cells.

Question 9

Which is a true statement about mitochondrial genomes?

Accepted Answer

A) In most cases, the mitochondrial genome is transmitted, largely intact, from one parent to offspring. 
B) Mitochondrial inheritance shows Mendel's principle of segregation. 
C) Mitochondrial inheritance shows Mendel's principle of independent assortment. 
D) All of the choices are correct. 
A) In most cases, the mitochondrial genome is transmitted, largely intact, from one parent to offspring. 
B) Mitochondrial inheritance shows Mendel's principle of segregation. 
C) Mitochondrial inheritance shows Mendel's principle of independent assortment. 
D) All of the choices are correct.

Question 10

Oocyte nuclear transfer can be used to

Accepted Answer

A) allow women with mitochondrial diseases to have normal offspring. 
B) allow women with any genetic disease to have normal offspring. 
C) allow parents to control all of the phenotypic characteristics of their children. 
D) create embryos for stem cell therapy. 
A) allow women with mitochondrial diseases to have normal offspring. 
B) allow women with any genetic disease to have normal offspring. 
C) allow parents to control all of the phenotypic characteristics of their children. 
D) create embryos for stem cell therapy.

Question 11

Which step in producing ATP is correctly paired with the location where it occurs?

Accepted Answer

A) Krebs cycle-mitochondrial matrix 
B) formation of an electrochemical gradient-cytoplasm 
C) glucose is broken down to produce pyruvate-space between inner and outer mitochondrial membranes 
D) electron transport chain-outer mitochondrial membrane 
E) breakdown of pyruvate to form NADH and FADH2-cytoplasm 
A) Krebs cycle-mitochondrial matrix 
B) formation of an electrochemical gradient-cytoplasm 
C) glucose is broken down to produce pyruvate-space between inner and outer mitochondrial membranes 
D) electron transport chain-outer mitochondrial membrane 
E) breakdown of pyruvate to form NADH and FADH2-cytoplasm

Question 12

Due to gene transfer between the organelles and the nucleus,

Accepted Answer

A) mitochondrial genomes in all species have the same genes. 
B) a chloroplast from one plant species can be transferred to any other plant species. 
C) mitochondria and chloroplasts have genes that allow them to live independently. 
D) some proteins must be imported into organelles for their function. 
E) organelle genomes experience lower rates of mutation than they would if gene transfer did not occur. 
A) mitochondrial genomes in all species have the same genes. 
B) a chloroplast from one plant species can be transferred to any other plant species. 
C) mitochondria and chloroplasts have genes that allow them to live independently. 
D) some proteins must be imported into organelles for their function. 
E) organelle genomes experience lower rates of mutation than they would if gene transfer did not occur.

Question 13

Variegated four o'clock leaves have white patches among the green areas due to

Accepted Answer

A) the presence of cells in which most of the mitochondria have a mutation that blocks electron transport. 
B) the presence of cells in which most of the chloroplasts have a mutation that prevents synthesis of chlorophyll. 
C) an incompletely penetrant mutation in a nuclear gene that prevents production of chlorophyll. 
D) a recessive mutation in a nuclear gene that results in a defect in ribosomes. 
A) the presence of cells in which most of the mitochondria have a mutation that blocks electron transport. 
B) the presence of cells in which most of the chloroplasts have a mutation that prevents synthesis of chlorophyll. 
C) an incompletely penetrant mutation in a nuclear gene that prevents production of chlorophyll. 
D) a recessive mutation in a nuclear gene that results in a defect in ribosomes.

Question 14

What does DNA sequencing suggest about the relationship between the nuclear and organellar genomes?

Accepted Answer

A) The same subset of mitochondrial genes has moved to the nuclear genome in all species. 
B) Mitochondrial genes that are found in the nuclear genome do not have introns, suggesting that movement occurred via an RNA intermediate. 
C) The mitochondrial and nuclear genomes are entirely independent of each other. 
D) Some cells have two types of mitochondria that have different genome sequences. 
E) Some proteins found in mitochondria are imported from the cytoplasm. 
A) The same subset of mitochondrial genes has moved to the nuclear genome in all species. 
B) Mitochondrial genes that are found in the nuclear genome do not have introns, suggesting that movement occurred via an RNA intermediate. 
C) The mitochondrial and nuclear genomes are entirely independent of each other. 
D) Some cells have two types of mitochondria that have different genome sequences. 
E) Some proteins found in mitochondria are imported from the cytoplasm.

Question 15

Which of the following has been associated with Alzheimer's Disease?

Accepted Answer

A) loss of mitochondria 
B) 5kb and 7.4kb deletions in mtDNA of heart cells 
C) mutations in cytochrome oxidase c genes in brain cells 
D) no change in mitochondrial function. 
A) loss of mitochondria 
B) 5kb and 7.4kb deletions in mtDNA of heart cells 
C) mutations in cytochrome oxidase c genes in brain cells 
D) no change in mitochondrial function.

Question 16

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′    
-If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?

Accepted Answer

A) Phe Asp His 
B) Met Asn Gly Trp 
C) Met Asn Gly 
D) Translation will not begin. 
A) Phe Asp His 
B) Met Asn Gly Trp 
C) Met Asn Gly 
D) Translation will not begin.

Question 17

Where are the proteins needed for photosynthesis produced? (Select all that apply. )

Accepted Answer

A) in the cytoplasm 
B) in the chloroplasts 
C) in the nucleus 
D) in the mitochondria 
A) in the cytoplasm 
B) in the chloroplasts 
C) in the nucleus 
D) in the mitochondria

Question 18

LHON is a mitochondrial disease caused by weak hypomorphic mutations that affect the mitochondrial electron transport chain.Among the first symptoms of the disease is blindness.People with LHON are usually homoplasmic because retinas must be homoplasmic mutant for a person to have disease symptoms.Which is true about a female who is heteroplasmic for the mutation that causes LHON? (Select all that apply. )

Accepted Answer

A) She may have children who are blind due to LHON. 
B) Some cells in her body are probably homoplasmic. 
C) She is likely to develop the disease in other parts of her body. 
D) All of her children will be homoplasmic for the wild-type mitochondria. 
A) She may have children who are blind due to LHON. 
B) Some cells in her body are probably homoplasmic. 
C) She is likely to develop the disease in other parts of her body. 
D) All of her children will be homoplasmic for the wild-type mitochondria.

Question 19

Researchers combined two yeast strains of opposite mating type; the a strain was resistant to chloramphenicol and the ? strain was sensitive to chloramphenicol. The diploid progeny were allowed to undergo several cell divisions, and then the cells were replica plated on glycerol medium with and without chloramphenicol.
-What results would you expect if mitochondria are inherited uniparentally from the ? strain?

Accepted Answer

A) Some, but not all, yeast colonies found on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
B) All of the yeast colonies on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
C) Many yeast colonies will grow on the plate without chloramphenicol and no colonies will grow on the plate with chloramphenicol. 
D) No colonies will grow on either plate. 
A) Some, but not all, yeast colonies found on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
B) All of the yeast colonies on the plate without chloramphenicol will also grow on the plate with chloramphenicol. 
C) Many yeast colonies will grow on the plate without chloramphenicol and no colonies will grow on the plate with chloramphenicol. 
D) No colonies will grow on either plate.

Question 20

For what purpose is a researcher likely to shoot plant cells with a gene gun?

Accepted Answer

A) to kill the cell 
B) to introduce new DNA into the chloroplast genome 
C) to introduce a mutation in the nuclear genome 
D) to add a transgene to the mitochondrial genome 
A) to kill the cell 
B) to introduce new DNA into the chloroplast genome 
C) to introduce a mutation in the nuclear genome 
D) to add a transgene to the mitochondrial genome

Which is an accurate description of organelle genomes? (Select all that apply. )

The codon UGA specifies

Which has been associated with aging in humans?

Why is a variegated plant considered heteroplasmic?

Inhibitors of bacterial translation, such as chloramphenicol and erythromycin, usually (Select all that apply. )

Extranuclear genes show a biparental inheritance pattern in yeast since

What would be the most likely result if a scientist removes mitochondria from a human cell and attempts to grow them in culture?

Which is a true statement about mitochondrial genomes?

Oocyte nuclear transfer can be used to

Which step in producing ATP is correctly paired with the location where it occurs?

Due to gene transfer between the organelles and the nucleus,

Variegated four o'clock leaves have white patches among the green areas due to

What does DNA sequencing suggest about the relationship between the nuclear and organellar genomes?

Which of the following has been associated with Alzheimer's Disease?

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?

Where are the proteins needed for photosynthesis produced? (Select all that apply. )

For what purpose is a researcher likely to shoot plant cells with a gene gun?

Genetics: the Study of Biological Information

Mendels Principles of Heredity

Extensions to Mendels Laws

The Chromosome Theory of Inheritance

Linkage, Recombination, and the Mapping of Genes on Chromosomes

DNA Structure, Replication, and Recombination

Anatomy and Function of a Gene: Dissection Through Mutation

Gene Expression: the Flow of Information From Dna to Rna to Protein

Digital Analysis of Dna

Genome Annotation

Analyzing Genomic Variation

The Eukaryotic Chromosome

Chromosomal Rearrangements and Changes in Chromosome Number

Bacterial Genetics

Gene Regulation in Prokaryotes

Gene Regulation in Eukaryotes

Manipulating the Genomes of Eukaryotes

The Genetic Analysis of Development

The Genetics of Cancer

Variation and Selection in Populations

The Genetics of Complex Traits

Filters

Exam 15: Organellar Inheritance

Which is an accurate description of organelle genomes? (Select all that apply. )

The codon UGA specifies

Which has been associated with aging in humans?

Why is a variegated plant considered heteroplasmic?

Inhibitors of bacterial translation, such as chloramphenicol and erythromycin, usually (Select all that apply. )

Extranuclear genes show a biparental inheritance pattern in yeast since

What would be the most likely result if a scientist removes mitochondria from a human cell and attempts to grow them in culture?

Which is a true statement about mitochondrial genomes?

Oocyte nuclear transfer can be used to

Which step in producing ATP is correctly paired with the location where it occurs?

Due to gene transfer between the organelles and the nucleus,

Variegated four o'clock leaves have white patches among the green areas due to

What does DNA sequencing suggest about the relationship between the nuclear and organellar genomes?

Which of the following has been associated with Alzheimer's Disease?

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed in the nucleus and translated in the cytoplasm, what amino acid sequence is encoded?

Where are the proteins needed for photosynthesis produced? (Select all that apply. )

For what purpose is a researcher likely to shoot plant cells with a gene gun?

Genetics: the Study of Biological Information

Mendels Principles of Heredity

Extensions to Mendels Laws

The Chromosome Theory of Inheritance

Linkage, Recombination, and the Mapping of Genes on Chromosomes

DNA Structure, Replication, and Recombination

Anatomy and Function of a Gene: Dissection Through Mutation

Gene Expression: the Flow of Information From Dna to Rna to Protein

Digital Analysis of Dna

Genome Annotation

Analyzing Genomic Variation

The Eukaryotic Chromosome

Chromosomal Rearrangements and Changes in Chromosome Number

Bacterial Genetics

Gene Regulation in Prokaryotes

Gene Regulation in Eukaryotes

Manipulating the Genomes of Eukaryotes

The Genetic Analysis of Development

The Genetics of Cancer

Variation and Selection in Populations

The Genetics of Complex Traits

Filters