The sequence of gene B from another baby frog who is homozygous for allele b2 is shown.What effect does the mutation in allele b2 have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′

A) Allele b2 has a frameshift mutation-a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C) Allele b2 has a missense mutation-a nucleotide substitution that changes one amino acid to another. D) Allele b2 has a nonsense mutation-a nucleotide substitution that forms a stop codon. E) Allele b2 has a silent mutation-a nucleotide substitution that does not change the protein. A) Allele b2 has a frameshift mutation-a deletion of one nucleotide resulting in a frameshift that changes all amino acids from that point on. B) Allele b2 has a deletion of one nucleotide outside of the coding region and there is no effect on the protein. C) Allele b2 has a missense mutation-a nucleotide substitution that changes one amino acid to another. D) Allele b2 has a nonsense mutation-a nucleotide substitution that forms a stop codon. E) Allele b2 has a silent mutation-a nucleotide substitution that does not change the protein.

Exam 9: Digital Analysis of Dna

The recognition site for a restriction enzyme is 5′ ACC^GGT 3′.The ^ symbol indicates the site of cleavage.After digestion of DNA with this restriction enzyme, how will the ends of the resulting DNA fragments look?

Free

(Multiple Choice)

4.9/5

(32)

Question 1

Correct Answer:

Verified

What is the origin and physiological function of restriction endonucleases?

Free

(Multiple Choice)

4.8/5

(36)

Question 2

Correct Answer:

Verified

Baby frog #1 is homozygous for a mutant allele of gene B (allele b¹).Compare the DNA sequence from baby frog #1 with the wild-type sequence to determine how allele b¹ is different from the wild-type.What effect does the mutation in allele b¹ have on the protein?

Free

(Multiple Choice)

4.8/5

(31)

Question 3

Correct Answer:

Verified

Which is a characteristic of a plasmid used as a cloning vector? (Select all that apply. )

(Multiple Choice)

4.9/5

(31)

Question 4

In gel electrophoresis, DNA fragments move at different rates because they have different

(Multiple Choice)

4.8/5

(30)

Question 5

The recognition site for a restriction enzyme is 5′ ACCGG^T 3′.The ^ symbol indicates the site of cleavage.After digestion of DNA with this restriction enzyme, how will the ends of the resulting DNA fragments look?

(Multiple Choice)

4.9/5

(36)

Question 6

What is the function of the amp^r gene in a plasmid vector?

(Multiple Choice)

4.8/5

(37)

Question 7

In Sanger sequencing, the role of the DNA polymerase is to

(Multiple Choice)

4.7/5

(36)

Question 8

Why was another nucleotide not added to the smallest fragment?

(Multiple Choice)

4.9/5

(30)

Question 9

The mouse genome consists of 2,700 Mb. A genomic library is constructed using BAC vectors and overlapping fragments of the mouse genome. The average size of the mouse DNA inserts is 200 kb. -A mouse genomic library is constructed so that the number of clones equals one genomic equivalent.Is it likely that this library contains the entire mouse genome?

(Multiple Choice)

4.8/5

(32)

Question 10

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. -What is the sequence of the template DNA used for this sequencing reaction?

(Multiple Choice)

4.8/5

(37)

Question 11

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. -Which is a step in hierarchical genome sequencing that is not found in shotgun genome sequencing?

(Multiple Choice)

4.8/5

(31)

Question 12

The mouse genome consists of 2,700 Mb. A genomic library is constructed using BAC vectors and overlapping fragments of the mouse genome. The average size of the mouse DNA inserts is 200 kb. -What is the minimum number of clones that should be in this mouse genomic library to have a 95% chance that it contains the entire genome?

(Multiple Choice)

4.7/5

(40)

Question 13

In frogs, green skin is determined by gene B.The wild-type sequence of the 5′ end of the RNA-like strand of the entire first exon is shown below.The gene encodes an enzyme that functions to convert a brown compound into a green pigment in the skin. 5′ ACTCAAGCACAGGTCGCATAAATGTTCCTGTTATTTGG… 3′ The table of codons is provided here: -Which are the first three amino acids encoded by the wild-type sequence of gene B?

(Multiple Choice)

4.9/5

(31)

Question 14

A third mutant allele of gene B (allele b³)causes the frogs' eyes to become green, instead of their normal red color.Normally, gene B effects only skin color.What term describes this allele?

(Multiple Choice)

4.8/5

(32)

Question 15

In Sanger sequencing, what causes DNA synthesis to terminate at a specific base?

(Multiple Choice)

4.9/5

(30)

Question 16

The sequence of gene B from another baby frog who is homozygous for allele b² is shown.What effect does the mutation in allele b² have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′

(Multiple Choice)

4.7/5

(45)

Question 17

The mouse genome consists of 2,700 Mb. A genomic library is constructed using BAC vectors and overlapping fragments of the mouse genome. The average size of the mouse DNA inserts is 200 kb. -How many clones would make up one genomic equivalent?

(Multiple Choice)

4.9/5

(34)

Question 18

Which method of fragmenting DNA would not be useful for sequencing a genome for the first time?

(Multiple Choice)

4.8/5

(34)

Question 19

Which is an example of a recombinant DNA molecule?

(Multiple Choice)

4.8/5

(25)

Question 20

Showing 1 - 20 of 29

The recognition site for a restriction enzyme is 5′ ACC^GGT 3′.The ^ symbol indicates the site of cleavage.After digestion of DNA with this restriction enzyme, how will the ends of the resulting DNA fragments look?

What is the origin and physiological function of restriction endonucleases?

Baby frog #1 is homozygous for a mutant allele of gene B (allele b¹).Compare the DNA sequence from baby frog #1 with the wild-type sequence to determine how allele b¹ is different from the wild-type.What effect does the mutation in allele b¹ have on the protein?

Which is a characteristic of a plasmid used as a cloning vector? (Select all that apply. )

In gel electrophoresis, DNA fragments move at different rates because they have different

The recognition site for a restriction enzyme is 5′ ACCGG^T 3′.The ^ symbol indicates the site of cleavage.After digestion of DNA with this restriction enzyme, how will the ends of the resulting DNA fragments look?

What is the function of the amp^r gene in a plasmid vector?

In Sanger sequencing, the role of the DNA polymerase is to

Why was another nucleotide not added to the smallest fragment?

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. -What is the sequence of the template DNA used for this sequencing reaction?

A third mutant allele of gene B (allele b³)causes the frogs' eyes to become green, instead of their normal red color.Normally, gene B effects only skin color.What term describes this allele?

In Sanger sequencing, what causes DNA synthesis to terminate at a specific base?

The sequence of gene B from another baby frog who is homozygous for allele b² is shown.What effect does the mutation in allele b² have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′

The mouse genome consists of 2,700 Mb. A genomic library is constructed using BAC vectors and overlapping fragments of the mouse genome. The average size of the mouse DNA inserts is 200 kb. -How many clones would make up one genomic equivalent?

Which method of fragmenting DNA would not be useful for sequencing a genome for the first time?

Which is an example of a recombinant DNA molecule?

Genetics: the Study of Biological Information

Mendels Principles of Heredity

Extensions to Mendels Laws

The Chromosome Theory of Inheritance

Linkage, Recombination, and the Mapping of Genes on Chromosomes

DNA Structure, Replication, and Recombination

Anatomy and Function of a Gene: Dissection Through Mutation

Gene Expression: the Flow of Information From Dna to Rna to Protein

Genome Annotation

Analyzing Genomic Variation

The Eukaryotic Chromosome

Chromosomal Rearrangements and Changes in Chromosome Number

Bacterial Genetics

Organellar Inheritance

Gene Regulation in Prokaryotes

Gene Regulation in Eukaryotes

Manipulating the Genomes of Eukaryotes

The Genetic Analysis of Development

The Genetics of Cancer

Variation and Selection in Populations

The Genetics of Complex Traits

Filters

Exam 9: Digital Analysis of Dna

The recognition site for a restriction enzyme is 5′ ACC^GGT 3′.The ^ symbol indicates the site of cleavage.After digestion of DNA with this restriction enzyme, how will the ends of the resulting DNA fragments look?

What is the origin and physiological function of restriction endonucleases?

Baby frog #1 is homozygous for a mutant allele of gene B (allele b1).Compare the DNA sequence from baby frog #1 with the wild-type sequence to determine how allele b1 is different from the wild-type.What effect does the mutation in allele b1 have on the protein?

Which is a characteristic of a plasmid used as a cloning vector? (Select all that apply. )

In gel electrophoresis, DNA fragments move at different rates because they have different

The recognition site for a restriction enzyme is 5′ ACCGG^T 3′.The ^ symbol indicates the site of cleavage.After digestion of DNA with this restriction enzyme, how will the ends of the resulting DNA fragments look?

What is the function of the ampr gene in a plasmid vector?

In Sanger sequencing, the role of the DNA polymerase is to

Why was another nucleotide not added to the smallest fragment?

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. -What is the sequence of the template DNA used for this sequencing reaction?

A third mutant allele of gene B (allele b3)causes the frogs' eyes to become green, instead of their normal red color.Normally, gene B effects only skin color.What term describes this allele?

In Sanger sequencing, what causes DNA synthesis to terminate at a specific base?

The sequence of gene B from another baby frog who is homozygous for allele b2 is shown.What effect does the mutation in allele b2 have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′

The mouse genome consists of 2,700 Mb. A genomic library is constructed using BAC vectors and overlapping fragments of the mouse genome. The average size of the mouse DNA inserts is 200 kb. -How many clones would make up one genomic equivalent?

Which method of fragmenting DNA would not be useful for sequencing a genome for the first time?

Which is an example of a recombinant DNA molecule?

Genetics: the Study of Biological Information

Mendels Principles of Heredity

Extensions to Mendels Laws

The Chromosome Theory of Inheritance

Linkage, Recombination, and the Mapping of Genes on Chromosomes

DNA Structure, Replication, and Recombination

Anatomy and Function of a Gene: Dissection Through Mutation

Gene Expression: the Flow of Information From Dna to Rna to Protein

Genome Annotation

Analyzing Genomic Variation

The Eukaryotic Chromosome

Chromosomal Rearrangements and Changes in Chromosome Number

Bacterial Genetics

Organellar Inheritance

Gene Regulation in Prokaryotes

Gene Regulation in Eukaryotes

Manipulating the Genomes of Eukaryotes

The Genetic Analysis of Development

The Genetics of Cancer

Variation and Selection in Populations

The Genetics of Complex Traits

Filters

Baby frog #1 is homozygous for a mutant allele of gene B (allele b¹).Compare the DNA sequence from baby frog #1 with the wild-type sequence to determine how allele b¹ is different from the wild-type.What effect does the mutation in allele b¹ have on the protein?

What is the function of the amp^r gene in a plasmid vector?

A third mutant allele of gene B (allele b³)causes the frogs' eyes to become green, instead of their normal red color.Normally, gene B effects only skin color.What term describes this allele?

The sequence of gene B from another baby frog who is homozygous for allele b² is shown.What effect does the mutation in allele b² have on the protein? 5′ AGGTCGCATAAATGTTCCTGTAATTTGG… 3′