Exam 15: Organellar Inheritance

LHON is a rare mitochondrial disease caused by weak hypomorphic mutations that affect the mitochondrial electron transport chain.The first symptoms of the disease include blindness.People with LHON are usually homoplasmic because retinas must be homoplasmic mutant for a person to have disease symptoms.Which is true about a male who is heteroplasmic for the mutation that causes LHON? (Select all that apply. )

What does UGA specify? (Select all that apply. )

What did comparing the sequence of the mitochondrial genome in trypanosomes with the sequence of mature mitochondrial RNAs demonstrate?

Which statement describes evidence in support of the endosymbiont theory?

In four o'clock plants, reciprocal crosses are performed with a green plant and a white plant.How will the offspring of the reciprocal crosses look?

What are characteristics of the pedigrees of families with mitochondrial diseases?

In plant cells, DNA molecules are found inside which structures? (Select all that apply. )

Researchers combined two yeast strains of opposite mating type; the a strain was resistant to chloramphenicol and the ? strain was sensitive to chloramphenicol. The diploid progeny were allowed to undergo several cell divisions, and then the cells were replica plated on glycerol medium with and without chloramphenicol. -What results would you expect if mitochondria are inherited uniparentally from the a strain?

This sequence is the 5′ end of a mRNA: 5′ UUCGACCAUUAACGGUUGAAGGUAG 3′ -If this mRNA is transcribed and translated in the mitochondria, what amino acid sequence is encoded?

Where are the molecules used to carry out photosynthesis encoded?

Which is true about mitochondria?