Question 1

Why isn't bacterial DNA digested by the restriction enzymes bacteria produce?

Accepted Answer

A) The sequence recognized and cleaved by a restriction enzyme is not found in the bacterial genome. 
B) Bacterial cells have high concentrations of ligase which immediately repairs the any sites that are cleaved. 
C) Methyl groups added to the bases of restriction enzyme recognition sites within the bacterial chromosome block cleavage. 
D) Bacterial DNA is modified with phosphate groups that prevent the function of restriction enzymes. 
E) Restriction enzymes are found in the cytoplasm and DNA is only in the nucleus. 
A) The sequence recognized and cleaved by a restriction enzyme is not found in the bacterial genome. 
B) Bacterial cells have high concentrations of ligase which immediately repairs the any sites that are cleaved. 
C) Methyl groups added to the bases of restriction enzyme recognition sites within the bacterial chromosome block cleavage. 
D) Bacterial DNA is modified with phosphate groups that prevent the function of restriction enzymes. 
E) Restriction enzymes are found in the cytoplasm and DNA is only in the nucleus.

Question 2

What is one difference between using restriction endonucleases and mechanical shearing of DNA?

Accepted Answer

A) Restriction endonucleases cut DNA at known specific sites while shearing occurs at random sites. 
B) Restriction endonucleases cut DNA at random sites while shearing occurs at known specific sites. 
C) DNA cut with restriction enzymes can be used for cloning and DNA broken by shearing cannot. 
D) Restriction enzymes produce larger fragments on average than shearing. 
A) Restriction endonucleases cut DNA at known specific sites while shearing occurs at random sites. 
B) Restriction endonucleases cut DNA at random sites while shearing occurs at known specific sites. 
C) DNA cut with restriction enzymes can be used for cloning and DNA broken by shearing cannot. 
D) Restriction enzymes produce larger fragments on average than shearing.

Question 3

Baby frog #1 was born with brown skin instead of the normal green.DNA was collected from the baby frog and the DNA sequence of part of gene B was determined using the primer 5′ ACTCAAGCACAGGTCG 3′.What is the entire sequence of the smallest DNA fragment produced in the sequencing reaction? (See diagram for sequencing data. ) https://commons.wikimedia.org/wiki/File:DNA_sequence.svg

Accepted Answer

A) C 
B) 5′ ACTCAAGCACAGGTCGC 
C) 5′ AGGTCGG 
D) 5′ CATAAATGTCCTGTTATTTGG 
E) 5′ CGACCTG 
A) C 
B) 5′ ACTCAAGCACAGGTCGC 
C) 5′ AGGTCGG 
D) 5′ CATAAATGTCCTGTTATTTGG 
E) 5′ CGACCTG

Question 4

Why does a genomic library need more clones than what would be estimated by calculations to be complete?

Accepted Answer

A) There is a significant probability that some sequences would not be represented in a library if it was only the calculated size. 
B) The restriction enzyme that is used to prepare the DNA for cloning will not digest certain sequences within the DNA. 
C) The restriction enzyme used to prepare the DNA for cloning sometimes leaves a different sticky end. 
D) Restriction enzymes cleave DNA preferentially at the ends of open reading frames so coding regions are preferentially cloned. 
A) There is a significant probability that some sequences would not be represented in a library if it was only the calculated size. 
B) The restriction enzyme that is used to prepare the DNA for cloning will not digest certain sequences within the DNA. 
C) The restriction enzyme used to prepare the DNA for cloning sometimes leaves a different sticky end. 
D) Restriction enzymes cleave DNA preferentially at the ends of open reading frames so coding regions are preferentially cloned.

Question 5

Which vector would be best to use if you want to construct a genomic library with the largest fragments possible?

Accepted Answer

A) YAC 
B) BAC 
C) Plasmid 
D) Virus 
A) YAC 
B) BAC 
C) Plasmid 
D) Virus

Question 6

Why is it necessary to obtain overlapping sequences when sequencing a genome for the first time?

Accepted Answer

A) To assemble the whole genome sequence virtually from random fragments 
B) To quantify the amount of DNA in the genome 
C) To make sure all the clones in a library are used 
D) To allow for sequencing errors to be corrected 
A) To assemble the whole genome sequence virtually from random fragments 
B) To quantify the amount of DNA in the genome 
C) To make sure all the clones in a library are used 
D) To allow for sequencing errors to be corrected

Question 7

What is the purpose of ethidium bromide in DNA electrophoresis?

Accepted Answer

A) To tag DNA fragments so they can be viewed under UV light 
B) To introduce mutations into the DNA 
C) To fragment the DNA before separating the pieces by size 
D) To join fragments of DNA together 
A) To tag DNA fragments so they can be viewed under UV light 
B) To introduce mutations into the DNA 
C) To fragment the DNA before separating the pieces by size 
D) To join fragments of DNA together

Question 8

Imagine that DNA is composed of equal proportions of six different types of nucleotide, instead of the normal four.The six nucleotides are A, C, G, T, X, and Y.In this new type of DNA molecule, A pairs with T, C pairs with G, and X pairs with Y.What would be the average size of the DNA fragments produced when this new DNA is cut by a restriction endonuclease with a four-base recognition sequence?

Accepted Answer

A) 125 bp 
B) 256 bp 
C) 425 bp 
D) 1056 bp 
E) 1296 bp 
A) 125 bp 
B) 256 bp 
C) 425 bp 
D) 1056 bp 
E) 1296 bp

Question 9

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace.  
-What is the sequence of the DNA synthesized in the sequencing reaction?

Accepted Answer

A) 5' TTTGCTTTGTGAGCGGATAACAA 3' 
B) 3' TTTGCTTTGTGAGCGGATAACAA 5' 
C) 5' AAACGAAACACTCGCCTATTGTT 3' 
D) 3' AAACGAAACACTCGCCTATTGTT 5' 
A) 5' TTTGCTTTGTGAGCGGATAACAA 3' 
B) 3' TTTGCTTTGTGAGCGGATAACAA 5' 
C) 5' AAACGAAACACTCGCCTATTGTT 3' 
D) 3' AAACGAAACACTCGCCTATTGTT 5'

Why isn't bacterial DNA digested by the restriction enzymes bacteria produce?

What is one difference between using restriction endonucleases and mechanical shearing of DNA?

Why does a genomic library need more clones than what would be estimated by calculations to be complete?

Which vector would be best to use if you want to construct a genomic library with the largest fragments possible?

Why is it necessary to obtain overlapping sequences when sequencing a genome for the first time?

What is the purpose of ethidium bromide in DNA electrophoresis?

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. -What is the sequence of the DNA synthesized in the sequencing reaction?

Genetics: the Study of Biological Information

Mendels Principles of Heredity

Extensions to Mendels Laws

The Chromosome Theory of Inheritance

Linkage, Recombination, and the Mapping of Genes on Chromosomes

DNA Structure, Replication, and Recombination

Anatomy and Function of a Gene: Dissection Through Mutation

Gene Expression: the Flow of Information From Dna to Rna to Protein

Genome Annotation

Analyzing Genomic Variation

The Eukaryotic Chromosome

Chromosomal Rearrangements and Changes in Chromosome Number

Bacterial Genetics

Organellar Inheritance

Gene Regulation in Prokaryotes

Gene Regulation in Eukaryotes

Manipulating the Genomes of Eukaryotes

The Genetic Analysis of Development

The Genetics of Cancer

Variation and Selection in Populations

The Genetics of Complex Traits

Filters

Exam 9: Digital Analysis of Dna

Why isn't bacterial DNA digested by the restriction enzymes bacteria produce?

What is one difference between using restriction endonucleases and mechanical shearing of DNA?

Why does a genomic library need more clones than what would be estimated by calculations to be complete?

Which vector would be best to use if you want to construct a genomic library with the largest fragments possible?

Why is it necessary to obtain overlapping sequences when sequencing a genome for the first time?

What is the purpose of ethidium bromide in DNA electrophoresis?

You performed a Sanger sequencing reaction and obtained the following read.In this figure, A = green, C = purple, G = black, T = red.The height of the peaks is unimportant.The smallest molecule is at the left of the trace. -What is the sequence of the DNA synthesized in the sequencing reaction?

Genetics: the Study of Biological Information

Mendels Principles of Heredity

Extensions to Mendels Laws

The Chromosome Theory of Inheritance

Linkage, Recombination, and the Mapping of Genes on Chromosomes

DNA Structure, Replication, and Recombination

Anatomy and Function of a Gene: Dissection Through Mutation

Gene Expression: the Flow of Information From Dna to Rna to Protein

Genome Annotation

Analyzing Genomic Variation

The Eukaryotic Chromosome

Chromosomal Rearrangements and Changes in Chromosome Number

Bacterial Genetics

Organellar Inheritance

Gene Regulation in Prokaryotes

Gene Regulation in Eukaryotes

Manipulating the Genomes of Eukaryotes

The Genetic Analysis of Development

The Genetics of Cancer

Variation and Selection in Populations

The Genetics of Complex Traits

Filters