Question 1

The DNA sequence GATCTGATCTGATCTGATCT is a(n)

Accepted Answer

A)  VNTR. 
B)  STR. 
C)  RFLP. 
D)  SNP. 
E)  protein-encoding gene. 
A)  VNTR. 
B)  STR. 
C)  RFLP. 
D)  SNP. 
E)  protein-encoding gene.

Question 2

Who invented DNA profiling?

Accepted Answer

A)  Godfrey Hardy 
B)  William Weinberg 
C)  Alec Jeffreys 
D)  Linus Pauling 
E)  Godfrey Hardy and William Weinberg 
A)  Godfrey Hardy 
B)  William Weinberg 
C)  Alec Jeffreys 
D)  Linus Pauling 
E)  Godfrey Hardy and William Weinberg

Question 3

A series of markers have the following frequencies.Which would be the most useful for DNA profiling?

Accepted Answer

A)  1/60 
B)  1/5,200 
C)  1/500 
D)  1/40 
E)  1/10 
A)  1/60 
B)  1/5,200 
C)  1/500 
D)  1/40 
E)  1/10

Question 4

An autosomal recessive disorder strikes 1 in 1,800 newborns in a population.The frequency of carriers of this disorder is approximately

Accepted Answer

A)  0.00055. 
B)  0.023. 
C)  0.045. 
D)  0.5. 
E)  100%. 
A)  0.00055. 
B)  0.023. 
C)  0.045. 
D)  0.5. 
E)  100%.

Question 5

A suspect's guilt seems highly likely when a very rare combination of markers is

Accepted Answer

A)  found in the population the suspect comes from and at the crime scene. 
B)  not found in the population the suspect comes from, but present at the crime scene. 
C)  found in the suspect's DNA but not at the crime scene or in the population the suspect comes from. 
D)  found in the population the suspect comes from, in the suspect's DNA, and at the crime scene. 
E)  not found in the population the suspect comes from, in the suspect's DNA, or at the crime scene. 
A)  found in the population the suspect comes from and at the crime scene. 
B)  not found in the population the suspect comes from, but present at the crime scene. 
C)  found in the suspect's DNA but not at the crime scene or in the population the suspect comes from. 
D)  found in the population the suspect comes from, in the suspect's DNA, and at the crime scene. 
E)  not found in the population the suspect comes from, in the suspect's DNA, or at the crime scene.

Question 6

Which of the choices best describes macroevolution?

Accepted Answer

A)  Individuals with one genotype reproduce more than individuals with another genotype in a population. 
B)  Many individuals move into a new area. 
C)  Mutation creates new alleles that are dominant. 
D)  A new species emerges. 
E)  Dominant and recessive allele frequencies are in equilibrium in a population. 
A)  Individuals with one genotype reproduce more than individuals with another genotype in a population. 
B)  Many individuals move into a new area. 
C)  Mutation creates new alleles that are dominant. 
D)  A new species emerges. 
E)  Dominant and recessive allele frequencies are in equilibrium in a population.

Question 7

For a very rare inherited disease,the frequency of heterozygotes in a population is

Accepted Answer

A)  half that of the dominant allele. 
B)  double that of the recessive allele. 
C)  very close to 0. 
D)  near 1. 
E)  100%. 
A)  half that of the dominant allele. 
B)  double that of the recessive allele. 
C)  very close to 0. 
D)  near 1. 
E)  100%.

Question 8

All of the genes in a population comprise its

Accepted Answer

A)  genotype. 
B)  gene pool. 
C)  gene frequency. 
D)  gene reservoir. 
E)  genome. 
A)  genotype. 
B)  gene pool. 
C)  gene frequency. 
D)  gene reservoir. 
E)  genome.

Question 9

An RFLP is a

Accepted Answer

A)  DNA probe used for hybridization experiments. 
B)  variation in size of a DNA segment cut by a specific restriction enzyme. 
C)  recessive form of a deleterious allele. 
D)  restrictive enzyme used to cut DNA. 
E)  copy number variant used in forensic investigations. 
A)  DNA probe used for hybridization experiments. 
B)  variation in size of a DNA segment cut by a specific restriction enzyme. 
C)  recessive form of a deleterious allele. 
D)  restrictive enzyme used to cut DNA. 
E)  copy number variant used in forensic investigations.

Question 10

The allele T is in 85 percent of a population (p=0.85).According to the Hardy-Weinberg equation,what percentage of the population will have the recessive allele t (q=?)?

Accepted Answer

A)  15% 
B)  50% 
C)  85% 
D)  100% 
E)  0% 
A)  15% 
B)  50% 
C)  85% 
D)  100% 
E)  0%

Question 11

The parts of the genome that are used in markers of identity in DNA profiling

Accepted Answer

A)  are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
B)  are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype. 
C)  are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
D)  are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype. 
E)  have very distinctive phenotypes that are associated with particular populations. 
A)  are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
B)  are in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype. 
C)  are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a phenotype. 
D)  are not in Hardy-Weinberg equilibrium and therefore not affected by natural selection acting on a genotype. 
E)  have very distinctive phenotypes that are associated with particular populations.

Question 12

CODIS is

Accepted Answer

A)  a fifteen-base DNA sequence used in DNA profiling. 
B)  a type of mutation used in forensic applications. 
C)  a system for crime laboratories to share DNA profiles. 
D)  the last name of the person who invented DNA profiling. 
E)  a technology used to amplify DNA found at crime scenes. 
A)  a fifteen-base DNA sequence used in DNA profiling. 
B)  a type of mutation used in forensic applications. 
C)  a system for crime laboratories to share DNA profiles. 
D)  the last name of the person who invented DNA profiling. 
E)  a technology used to amplify DNA found at crime scenes.

Question 13

In the Hardy-Weinberg equation,2pq refers to

Accepted Answer

A)  the proportion of heterozygotes in a population. 
B)  the number of homozygous dominant individuals in a population. 
C)  the most common phenotype in a population. 
D)  individuals who are homozygous recessive. 
E)  individuals with a mutation. 
A)  the proportion of heterozygotes in a population. 
B)  the number of homozygous dominant individuals in a population. 
C)  the most common phenotype in a population. 
D)  individuals who are homozygous recessive. 
E)  individuals with a mutation.

Question 14

In a population in Hardy-Weinberg equilibrium,the frequency of recessive alleles will _______ over time.

Accepted Answer

A)  increase 
B)  decrease 
C)  remain the same 
D)  increase and then decrease 
E)  decrease and then increase 
A)  increase 
B)  decrease 
C)  remain the same 
D)  increase and then decrease 
E)  decrease and then increase

Question 15

Which of the following would not alter a gene's frequency in a population?

Accepted Answer

A)  mutation 
B)  migration 
C)  random mating 
D)  inbreeding 
E)  a bottleneck 
A)  mutation 
B)  migration 
C)  random mating 
D)  inbreeding 
E)  a bottleneck

Question 16

Gene flow is the

Accepted Answer

A)  migration of individuals between populations. 
B)  transfer of genes within a population. 
C)  variation of alleles within a population. 
D)  movement of alleles between populations. 
E)  change of normal genes to mutant alleles. 
A)  migration of individuals between populations. 
B)  transfer of genes within a population. 
C)  variation of alleles within a population. 
D)  movement of alleles between populations. 
E)  change of normal genes to mutant alleles.

Question 17

Tay-Sachs disease affects in 1 in 3,600 Ashkenazim births.The value of q2 is

Accepted Answer

A)  0.1. 
B)  0.05. 
C)  0.017. 
D)  0.0003. 
E)  100%. 
A)  0.1. 
B)  0.05. 
C)  0.017. 
D)  0.0003. 
E)  100%.

The DNA sequence GATCTGATCTGATCTGATCT is a(n)

Who invented DNA profiling?

A series of markers have the following frequencies.Which would be the most useful for DNA profiling?

An autosomal recessive disorder strikes 1 in 1,800 newborns in a population.The frequency of carriers of this disorder is approximately

A suspect's guilt seems highly likely when a very rare combination of markers is

Which of the choices best describes macroevolution?

For a very rare inherited disease,the frequency of heterozygotes in a population is

All of the genes in a population comprise its

An RFLP is a

The allele T is in 85 percent of a population (p=0.85).According to the Hardy-Weinberg equation,what percentage of the population will have the recessive allele t (q=?)?

The parts of the genome that are used in markers of identity in DNA profiling

CODIS is

In the Hardy-Weinberg equation,2pq refers to

In a population in Hardy-Weinberg equilibrium,the frequency of recessive alleles will _______ over time.

Which of the following would not alter a gene's frequency in a population?

Gene flow is the

Tay-Sachs disease affects in 1 in 3,600 Ashkenazim births.The value of q² is

Overview of Genetics

Cells

Meiosis and Development

Single-Gene Inheritance

Beyond Mendels Law

Matters of Sex

Multifactorial Traits

Genetics of Behavior

DNA Structure and Replication

Gene Action: From Dna to Protein

Gene Expression and Epigenetics

Gene Mutation

Chromosomes

Changing Allele Frequencies

Human Ancestry

Genetics of Immunity

Genetics of Cancer

Genetic Technologies: Amplifying, Modifying, and Monitoring DNA

Genetic Testing and Treatment

Reproductive Technologies

Genomics

Filters

Exam 14: Constant Allele Frequencies

The DNA sequence GATCTGATCTGATCTGATCT is a(n)

Who invented DNA profiling?

A series of markers have the following frequencies.Which would be the most useful for DNA profiling?

An autosomal recessive disorder strikes 1 in 1,800 newborns in a population.The frequency of carriers of this disorder is approximately

A suspect's guilt seems highly likely when a very rare combination of markers is

Which of the choices best describes macroevolution?

For a very rare inherited disease,the frequency of heterozygotes in a population is

All of the genes in a population comprise its

An RFLP is a

The allele T is in 85 percent of a population (p=0.85).According to the Hardy-Weinberg equation,what percentage of the population will have the recessive allele t (q=?)?

The parts of the genome that are used in markers of identity in DNA profiling

CODIS is

In the Hardy-Weinberg equation,2pq refers to

In a population in Hardy-Weinberg equilibrium,the frequency of recessive alleles will _______ over time.

Which of the following would not alter a gene's frequency in a population?

Gene flow is the

Tay-Sachs disease affects in 1 in 3,600 Ashkenazim births.The value of q2 is

Overview of Genetics

Cells

Meiosis and Development

Single-Gene Inheritance

Beyond Mendels Law

Matters of Sex

Multifactorial Traits

Genetics of Behavior

DNA Structure and Replication

Gene Action: From Dna to Protein

Gene Expression and Epigenetics

Gene Mutation

Chromosomes

Changing Allele Frequencies

Human Ancestry

Genetics of Immunity

Genetics of Cancer

Genetic Technologies: Amplifying, Modifying, and Monitoring DNA

Genetic Testing and Treatment

Reproductive Technologies

Genomics

Filters

Tay-Sachs disease affects in 1 in 3,600 Ashkenazim births.The value of q² is