Exam 13: Translation of MRNA

A protein called actin consists of 376 amino acids. The mRNA for actin must be longer than

What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

The primary structure of a protein is directly associated with ______.

What typically stops the process of translation?

The C-terminus of a polypeptide always contains

Consider the following mRNA from a eukaryotic species. Which AUG codon is translation most likely to begin from? 5'-CCUAUGAGCCACCAUGGAUGCCAAAUGCA-3'

An anticodon is located on ______.

You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?

A tRNA that has an amino acid attached is called _____.

A polyribosome would be found in which of the following types of cells?

In the digestive system of animals, proteins called amylases and proteases break down large molecules (for example, starches or proteins) into smaller ones so that they can be absorbed by the intestine. What category of protein function do these proteins fall into?

The genetic code is universal in nuclear DNA from bacteria to mammals.

How many amino acids would be included in the polypeptide encoded by the following mRNA: 5'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'

Where are the ribosomal subunits assembled in eukaryotes?

What is true according to the adaptor hypothesis?

Select the codon that is not synonymous with CUU.

61 different tRNAs are required for translation both in vivo and in vitro.

$\alpha$ -helices and $\beta$ -sheets are examples of what level of protein structure?

RF1 and RF2 are active during _______.

Select the amino acid that has been activated by aminoacyl-tRNA synthetase.