Exam 13: Gene Mutations, Transposable Elements, and Dna Repair

A scientist created a new auxotrophic mutant of bacteria that is leu^- for a new Ames test.In order for the mutant to grow in the absence of leucine, a(n)_____ mutation would have to occur in the _____ gene.

Which of the following statements about an animal bearing a somatic mutation is TRUE?

Transposable elements that transpose through an RNA intermediate are retrotransposons.There are two types of retrotransposons, those that have direct repeats at each end, often called long terminal repeats (LTRs), and those that do not have these repeats.Pick an example of each type of retrotransposon and give: (1)its basic structure, and (2)its possible evolutionary history.

The mutagen EMS converts guanine (G)to O-6-ethylguanine (G*).O-6-ethylguanine (G*)forms base pairs with thymine (T)instead of cytosine (C).Suppose that exposure to EMS damages a DNA molecule as shown below. Characterize the mutation induced by EMS as a transition, transversion, or frameshift.

Which of the following pairs of sequences would you expect to be found in the same transposable element?

Which of the following CORRECTLY describes nonsense mutations?

_____ mutations produce new activities and are usually dominant.

How can spontaneous mutations arise?

Assume that you discovered a new chemical mutagen that modifies guanine so that is mispairs with adenine when adenine is in the template DNA strand during DNA replication.However, this mispairing is limited to when the modified guanine is being added to the newly replicating DNA strand.When the modified guanine is in the template DNA strand it always pairs normally with cytosine being added to the growing newly-synthesized strand.What type of mutation would you predict would be caused by the new chemical mutagen?

Explain how transposable elements might play a role in studying gene function.

Which of the following enzyme activities is NOT a part of nucleotide-excision repair?

What is the consequence of a transversion mutation in duplex DNA?

Suppose a research study shows that people who suffer from severe depression are homozygous for a mutation in the hypothetical DEP gene.Individuals without this form of depression have the following sequence at the beginning of the translated region of their DEP genes 5'-ATG ACG TTT GAA ATT CAG TCT AGA-3'(MET THR PHE GLU ILE GLN SER ARG).Affected individuals have the following sequence 5'-ATG ACG TTT GAA ATT TAG TCT AGA-3'(MET THR PHE GLU ILE STOP).The mutation identified is most likely a:

Why do insertions and deletions often have more drastic phenotypic effects than do base substitutions?

Ultraviolet light causes what type of DNA lesion?

Upon transposing to a new site, transposable elements:

What would be the result of a large deletion in the resolvase gene of a transposable element?

A diploid fungal cell is homozygous for a (TTG)₅ trinucleotide repeat at a particular locus (see sequence below).During meiosis, an unequal crossover occurs at this locus between the second and third repeats on one homolog and between the third and fourth on the other.How many TTG repeats will each of the meiotic products have? (Assume that this species makes tetrads.) ATGTTGTTGTTGTTGTTGTGA

A _____ mutation changes a codon that specifies an amino acid into one that terminates translation.

Consider two theoretical transposable elements in yeast, A and B.Each contains an intron and each transposed to a new location in the yeast genome.Suppose you then examine the transposons for the presence of the intron.In the new locations, you find that A has no intron but B does.From these facts, what can you conclude about the mechanisms of transposition for the two transposable elements?